View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17540_low_14 (Length: 328)
Name: NF17540_low_14
Description: NF17540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17540_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 138 - 310
Target Start/End: Complemental strand, 43864093 - 43863920
Alignment:
| Q |
138 |
atgacgagcccatactcacgggtccacttcgaccatttgcaactgcaactaagaaacaaagttgagaaagttactagtaatt-acccagacactaaaggt |
236 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43864093 |
atgacgaacccatactcacgggtccacttcgaccatttgcaactgcaactaagaaacaaagttgagaaagttactagtaatttacccagacactaaaggt |
43863994 |
T |
 |
| Q |
237 |
tagaagtgttcatcatactaaaatatccaacatagattttgtagaaaatatcttctcaaactcaatgcttagtt |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43863993 |
tagaagtgttcatcatactaaaatatccaacatagattttgtagaaaatatcttctcaaactcaatgcttagtt |
43863920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 43864190 - 43864091
Alignment:
| Q |
17 |
tcatttctatccttaattatgaaaacaattttaatcaaagatttttaagtattagtcttcaatagacaatatgagatattttctccacacataacaaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864190 |
tcatttctatccttaattatgaaaacaattttaatcaaagatttttaaatattagtcttcaatagacaatatgagatattttctccacacataacaaatg |
43864091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University