View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17540_low_19 (Length: 254)
Name: NF17540_low_19
Description: NF17540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17540_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 171
Target Start/End: Original strand, 130578 - 130723
Alignment:
| Q |
19 |
gatgttcctctggagcattgactatcacgatctttgtttgtttaaactttgaagtgttaataatttgaaataaatacnnnnnnnnnnnnntaagaatgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
130578 |
gatgttcctctggagcattgactatcacgatctttgtttgtttaaa-------gtgttaataatttgaaataaatacaaaaaaataaaaataagaatgat |
130670 |
T |
 |
| Q |
119 |
tgttattctttctccaatatactcctacctttcttcgctcggtcggtctgtaa |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
130671 |
tgttattctttctccaatatactcctacctttcttcgctcggtcggtctgtaa |
130723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University