View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17541_high_1 (Length: 326)
Name: NF17541_high_1
Description: NF17541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17541_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 8 - 311
Target Start/End: Original strand, 35696270 - 35696573
Alignment:
| Q |
8 |
ccaagaatataggatttatggttgaaaaggcaccaacctttaaagctcttttagtatatatagaggtaatatttcttttaacatttaattatctaattca |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696270 |
ccaagagtataggatttatggttgaaaaggcaccaacctttaaagctcttttagtatatatagaggtaatatttcttttaacatttaattatctaattcg |
35696369 |
T |
|
| Q |
108 |
aatattttatttgagtttaccatattataacactcttaataactttatatcagcatcggtattatggaaaatcagtaccatttgggtcaagggaagaagc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35696370 |
aatattttatttgagtttaccatattataacactcttaataactttatatcagcatcggtattatggaaaatcggtaccatttgggtcaagggaagaagc |
35696469 |
T |
|
| Q |
208 |
gttcaagaatggaaacacacttggatattttaactcggctcaagcacttgcagattatgcagaagtgatcatagacataaagaagacattgcatgcccaa |
307 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35696470 |
gttcaagaatgcaaacacacttggatattttaactcggctcaagcacttgcagattatgcagaagtgatcatagacataaagaagacattgcatgcccaa |
35696569 |
T |
|
| Q |
308 |
aact |
311 |
Q |
| |
|
|||| |
|
|
| T |
35696570 |
aact |
35696573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University