View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17541_high_2 (Length: 275)
Name: NF17541_high_2
Description: NF17541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17541_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 265
Target Start/End: Original strand, 10229170 - 10229415
Alignment:
| Q |
20 |
atcttgtgattatgagttttgatccatggagagatggaaatgccattagattccggttgatgtgataatcaagagagaccagttcatatgaatcatataa |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10229170 |
atcttgtgattatgcgttttgatccatggagagatggaaatgccattagattccggttgatgtgataatcaagagagaccagttcatatgaatcatataa |
10229269 |
T |
 |
| Q |
120 |
agggctaccacaatcccacattgccctagctttttcttcttctttctcatcaactttgtccttcaatgcttcttgttcatcattttcaaattcttttcca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10229270 |
agggctaccacaatcccacattgccctagctttttcttcttctttctcatcaactttgcccttcaatgcttcttgttcatcattttcaaattcttttcca |
10229369 |
T |
 |
| Q |
220 |
ttcatgttggnnnnnnncatctcaattttcttatattcatcctttg |
265 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10229370 |
ttcatgttggtttttttcatctcaattttcttatattcatcctttg |
10229415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 20 - 265
Target Start/End: Complemental strand, 9602765 - 9602519
Alignment:
| Q |
20 |
atcttgtgattatgagttttgatccatggagagatggaaatgccattagattccggttgatgtgataatcaagagagaccagttcatatgaatcatataa |
119 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9602765 |
atcttgtgattatgcgtttcgattcatggagagatggaaatgccattagattccggttgatgtgataatcaagagagaccagttcatatgaatcatataa |
9602666 |
T |
 |
| Q |
120 |
agggctaccacaatcccacattgccctagctttttcttcttctttctcatcaactttgtccttcaatgcttcttgttcatcattttcaaattcttttcca |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||| |||||||| | |
|
|
| T |
9602665 |
agggctgccacaatcccacattgccctagctttttcttcttctttctcatcaactttgcccttaaatgcttcttgttcatccttttcaatttcttttcta |
9602566 |
T |
 |
| Q |
220 |
ttcatgtt-ggnnnnnnncatctcaattttcttatattcatcctttg |
265 |
Q |
| |
|
||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
9602565 |
ctcatgttagttttttgtcatctcaattttcttacattcatcctttg |
9602519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University