View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17542_high_11 (Length: 317)
Name: NF17542_high_11
Description: NF17542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17542_high_11 |
 |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (2 HSPs) |
 |  |  |
|
| [»] scaffold0709 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (3 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (3 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (3 HSPs) |
 |  |  |
|
| [»] scaffold0123 (2 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (3 HSPs) |
 |  |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 144)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 11346854 - 11346769
Alignment:
| Q |
1 |
gttcttgctttctattgatgaa-acatgaaaaaggtttctttgctttctataatccgatctaacgatgtcagcaatttgcattgtta |
86 |
Q |
| |
|
|||||||||||| |||||| || | |||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11346854 |
gttcttgctttccattgatcaagaaatgaaaaaggtttctt-gctttctaaaattcgatctaacgatgtcagcaatttgcattgtta |
11346769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 86 - 159
Target Start/End: Complemental strand, 11346719 - 11346646
Alignment:
| Q |
86 |
aacctctcaagaagtacatgtccaagtgtttatatttattagattccttacaaaaaatcttatcaaatatttta |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
11346719 |
aacctctcaagaagtacatgtccaagtgtttttatttattaaatttttttaaaaaaatcttatcaaatatttta |
11346646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 149 - 208
Target Start/End: Complemental strand, 12612370 - 12612311
Alignment:
| Q |
149 |
caaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12612370 |
caaattttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagtttta |
12612311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 19296405 - 19296355
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19296405 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatcc |
19296355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 494407 - 494460
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
494407 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
494460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 494750 - 494697
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
494750 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttg |
494697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 1890459 - 1890411
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1890459 |
tattttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
1890411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 7156158 - 7156103
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
7156158 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 8680777 - 8680909
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
8680777 |
ctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggt-aaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
8680875 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8680876 |
tgaaaatagtccctgaccccacttttgtgatgat |
8680909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 15076202 - 15076147
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
15076202 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15076147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 19321138 - 19321083
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
19321138 |
tattttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19321083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 24274129 - 24274074
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
24274129 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 31166872 - 31166927
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
31166872 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
31166927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 33801741 - 33801686
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
33801741 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
33801686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 778040 - 777994
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
778040 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttagtttta |
777994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 15962387 - 15962341
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15962387 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
15962341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 34582531 - 34582577
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34582531 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
34582577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 164 - 217
Target Start/End: Original strand, 543365 - 543418
Alignment:
| Q |
164 |
aaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 3356144 - 3356197
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
3356144 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttg |
3356197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 3356495 - 3356450
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3356450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 17771913 - 17771966
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
17771913 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttg |
17771966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 26376042 - 26375997
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
26375997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 14655376 - 14655436
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
14655376 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 15962023 - 15962075
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
15962023 |
tttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
15962075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 21994407 - 21994355
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
21994407 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
21994355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 23770442 - 23770398
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23770442 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| ||| |||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 7155799 - 7155854
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
7155799 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7155854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 8681114 - 8681059
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| ||| |||| |
|
|
| T |
8681114 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 12176650 - 12176595
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
12176650 |
tattttaggttaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
12176595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 12419710 - 12419761
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
12419710 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcct |
12419761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 12419936 - 12419881
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
12419936 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 22822649 - 22822610
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22822649 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
22822610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 25431857 - 25431806
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
25431857 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25431806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 32885675 - 32885730
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
32885675 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
32885730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 34582895 - 34582844
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
34582895 |
ttaggctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
34582844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1007507 - 1007461
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1007507 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1007461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2615874 - 2615920
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
2615874 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
2615920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3414389 - 3414435
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
3414389 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3414435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3969007 - 3968961
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
3969007 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3968961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 6412212 - 6412266
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
6412212 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6412266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 12299138 - 12299092
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
12299138 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
12299092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14428652 - 14428698
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
14428652 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
14428698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 20467716 - 20467670
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
20467716 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20467670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21995066 - 21995112
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
21995066 |
ctaaaatatggttttagtccctgcatatatgcctcgttttggtttta |
21995112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 22543356 - 22543402
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
22543356 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22543402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 22792897 - 22792851
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
22792897 |
ctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
22792851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 23502538 - 23502492
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23502538 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 23770163 - 23770209
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23770163 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23770209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24273830 - 24273876
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
24273830 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
24273876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 25137355 - 25137309
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
25137355 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25137309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 26375695 - 26375745
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
26375695 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatcc |
26375745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30928683 - 30928729
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
30928683 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30928729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 30929042 - 30928996
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30929042 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30928996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 317807 - 317860
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
317807 |
ttttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
317860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 1007119 - 1007172
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
1007119 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1007172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 2616238 - 2616193
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
2616238 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 3276352 - 3276299
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
3276352 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
3276299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 6591117 - 6591162
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6591117 |
ctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 7324189 - 7324144
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
7324144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 9896635 - 9896582
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |||||| |
|
|
| T |
9896635 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttg |
9896582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 14428948 - 14428895
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |||||| |||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttg |
14428895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 23502239 - 23502284
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
23502239 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 34990312 - 34990267
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
34990267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 8170159 - 8170103
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
8170159 |
atattctaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8170103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 22543722 - 22543670
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
22543722 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
22543670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 543722 - 543667
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||| |||||||||| |||| |
|
|
| T |
543722 |
ctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggt |
543667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 2373181 - 2373220
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2373181 |
ctaaaatatggttttagtccctgcaaatatgccttgtttt |
2373220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 6412577 - 6412538
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6412577 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttt |
6412538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 145 - 208
Target Start/End: Complemental strand, 6564958 - 6564896
Alignment:
| Q |
145 |
ttatcaaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
6564958 |
ttatcatatattttaggctaaaat-tggttttggtccctgcaaatatgtctcgttttggtttta |
6564896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 11449167 - 11449128
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11449167 |
ctaaaatatggttttagtccttgcaaatatgcctcgtttt |
11449128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 21995423 - 21995384
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21995423 |
ctaaaatatggttttagtccttgcaaatatgcctcgtttt |
21995384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 24692977 - 24692938
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24692977 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
24692938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 31167198 - 31167159
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31167198 |
ctaaaatatggttttagtccctgcaaatatggctcgtttt |
31167159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 33808622 - 33808661
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33808622 |
ctaaaatatggttttagtccctgtaaatatgcctcgtttt |
33808661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 34989963 - 34990002
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34989963 |
ctaaaatatgcttttagtccctgcaaatatgcctcgtttt |
34990002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 1890062 - 1890100
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgtttt |
1890100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3968647 - 3968693
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
3968647 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3968693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 6468312 - 6468358
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
6468312 |
ctaaaatatggttttagtccctgcaaatatgctttgttttggtttta |
6468358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6591440 - 6591394
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
6591394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9896280 - 9896326
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagtttta |
9896326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10910962 - 10910916
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
10910962 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10910916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11448539 - 11448585
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
11448539 |
ctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
11448585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12611997 - 12612043
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
12611997 |
ctaaaatatggtgttagtccctgcaaatatgccctgttttagtttta |
12612043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12757612 - 12757658
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
12757612 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12757658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 13268111 - 13268149
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13268111 |
ctaaaatatggttttggtccctgcaaatatgcctcgttt |
13268149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13617531 - 13617577
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
13617577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 196
Target Start/End: Complemental strand, 15117038 - 15117004
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15117038 |
ctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 17765011 - 17765057
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
17765011 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17765057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 19320769 - 19320819
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatcc |
19320819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19690395 - 19690441
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
19690395 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19690441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21147406 - 21147452
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
21147406 |
ctaaaatatggttttggtccctgcaaatatgcatcgttttggtttta |
21147452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21385253 - 21385299
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
21385253 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
21385299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 21385582 - 21385536
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
21385582 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
21385536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 22822309 - 22822355
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
22822309 |
ctaaaatatggttttagtctctgcaaatatacctcgttttggtttta |
22822355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24901241 - 24901287
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
24901241 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24901287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25136996 - 25137042
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
25136996 |
ctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
25137042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 31186589 - 31186543
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
31186589 |
ctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgtttta |
31186543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31198617 - 31198663
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
31198617 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
31198663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 33131848 - 33131802
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
33131848 |
ctaaaatatggttttagtctttgcaaatatgcctcgttttggtttta |
33131802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 10091039 - 10091084
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
10091084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 11129541 - 11129496
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
11129541 |
ctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 12298825 - 12298870
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgtttta |
12298870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 20467354 - 20467399
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
20467399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 31398539 - 31398486
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||| |||||| |||||| |
|
|
| T |
31398539 |
ctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttg |
31398486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 494661 - 494629
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
494661 |
gaaaatagtccctgaccccacttttgtgatgat |
494629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 11129302 - 11129334
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11129302 |
gaaaatagtccctgaccccacttttgtgatgat |
11129334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 14655669 - 14655637
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14655669 |
gaaaatagtccctgaccccacttttgtgatgat |
14655637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 17321453 - 17321421
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17321453 |
gaaaatagtccctgaccccacttttgtgatgat |
17321421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 17321586 - 17321554
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17321586 |
gaaaatagtccctgaccccacttttgtgatgat |
17321554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 19129528 - 19129472
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||| |||| ||||||||||||||| | |||||| |||||| |
|
|
| T |
19129528 |
atattttaggctaaaatatgattttggtccctgcaaatatgtcacgttttggtttta |
19129472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 19296305 - 19296273
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19296305 |
gaaaatagtccctgaccccacttttgtgatgat |
19296273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 24273939 - 24273971
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24273939 |
gaaaatagtccctgaccccacttttgtgatgat |
24273971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 30928944 - 30928912
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30928944 |
gaaaatagtccctgaccccacttttgtgatgat |
30928912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 31398440 - 31398408
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31398440 |
gaaaatagtccctgaccccacttttgtgatgat |
31398408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 33801642 - 33801610
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33801642 |
gaaaatagtccctgaccccacttttgtgatgat |
33801610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 777679 - 777734
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||| |||||| ||| |||| |
|
|
| T |
777679 |
ctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt |
777734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 1875496 - 1875543
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||| ||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
1875496 |
attttaggctaaaatatagctttaatccctgcaaatatgcctcgtttt |
1875543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 15442939 - 15442978
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
15442939 |
ctaaaatatggttttggtccctgcaaatatacctcgtttt |
15442978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 18024378 - 18024327
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
18024378 |
ttaggctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
18024327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 19296110 - 19296149
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
19296110 |
ctaaaacatggttttagtccctgcaaatatgcgtcgtttt |
19296149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 25121503 - 25121448
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||| ||||||| |||||| |
|
|
| T |
25121503 |
tattttaggctaaaatatggttttggtgcctgcaaatatgtttcgttttggtttta |
25121448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 318095 - 318049
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
318095 |
ctaaaatatggttttaatccctgcaaatatgtttcgttttggtttta |
318049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3414750 - 3414704
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||| |||||| |
|
|
| T |
3414750 |
ctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
3414704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12176387 - 12176433
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||| || || ||||||| ||||||||||||||| |
|
|
| T |
12176387 |
ctaaaatatggttttagcccatgtaaatatgtctcgttttagtttta |
12176433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14656258 - 14656212
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
14656258 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
14656212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 15116668 - 15116719
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
15116668 |
ttttaggctaaaatatggttttagtcgctgcaaatat--ctcgttttggtttta |
15116719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 17765373 - 17765327
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
17765373 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttattttta |
17765327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 208
Target Start/End: Original strand, 19129342 - 19129384
Alignment:
| Q |
166 |
aatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
19129342 |
aatatggctttggtccctgcaaatatgcctcgttttggtttta |
19129384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19267567 - 19267613
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
19267567 |
ctaaaatatggttttggtccctgtaaatatgcttcgttttggtttta |
19267613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21993789 - 21993835
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
21993789 |
ctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
21993835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30239295 - 30239341
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
30239295 |
ctaaaatatgattttagttcctgcaaatatgtctcgttttggtttta |
30239341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 30479420 - 30479374
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||| |||||| |
|
|
| T |
30479420 |
ctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
30479374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 18024014 - 18024059
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggtttta |
18024059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 201
Target Start/End: Complemental strand, 19690755 - 19690718
Alignment:
| Q |
164 |
aaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt |
19690718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 31166971 - 31167000
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31166971 |
gaaaatagtccctgaccccacttttgtgat |
31167000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 543622 - 543590
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
543622 |
gaaaatagtccatgaccccacttttgtgatgat |
543590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 2616134 - 2616102
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
2616134 |
gaaaatagtccctgaccacacttttgtgatgat |
2616102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 5286687 - 5286719
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
5286687 |
gaaaatagtccctggccccacttttgtgatgat |
5286719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 208
Target Start/End: Complemental strand, 13617804 - 13617768
Alignment:
| Q |
172 |
gttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggtttta |
13617768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 15076103 - 15076071
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
15076103 |
gaaaatagtccctgaccccacttttatgatgat |
15076071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 15116773 - 15116805
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
15116773 |
gaaaatagtccctgtccccacttttgtgatgat |
15116805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 24692880 - 24692848
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
24692880 |
gaaaatagtccctgacctcacttttgtgatgat |
24692848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 34582631 - 34582663
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
34582631 |
gaaaatagtccctgatcccacttttgtgatgat |
34582663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 49; Significance: 5e-19; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 153 - 217
Target Start/End: Original strand, 4034 - 4098
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
4034 |
tattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
4098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 153 - 217
Target Start/End: Original strand, 19216 - 19280
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
19216 |
tattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
19280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 4286 - 4231
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
4286 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
4231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 19468 - 19413
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
19468 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
19413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 12184 - 12316
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| | || |||||||||||||||||||||| |
|
|
| T |
12184 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccct-gtaaaataaaaattttgtttttggtccctgcaaaattttttgtttt |
12282 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12283 |
tgaaaatagtccctgaccccacttttgtgatgat |
12316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 12534 - 12481
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
12534 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttg |
12481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 175)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 152 - 212
Target Start/End: Complemental strand, 35345625 - 35345565
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
35345625 |
atattttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatcc |
35345565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 215
Target Start/End: Original strand, 10776148 - 10776203
Alignment:
| Q |
160 |
gtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
10776148 |
gtctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttg |
10776203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 1685117 - 1685171
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt |
1685171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 4016907 - 4016957
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4016907 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatcc |
4016957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40066499 - 40066545
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40066499 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
40066545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 32418320 - 32418373
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32418320 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
32418373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 10337452 - 10337401
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10337452 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
10337401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 19494411 - 19494356
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
19494411 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 22917566 - 22917621
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
22917566 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 38930662 - 38930607
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
38930662 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1408351 - 1408305
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1408351 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
1408305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1525811 - 1525857
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1525811 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1525857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4375694 - 4375740
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4375694 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 10755526 - 10755476
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10755526 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatcc |
10755476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10776497 - 10776451
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10776497 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10776451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 11019863 - 11019809
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
11019863 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11019809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14239078 - 14239032
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14239078 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14239032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14495071 - 14495117
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14495071 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14495117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 16789367 - 16789321
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16789367 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16789321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 20277694 - 20277740
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20277694 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20277740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21064321 - 21064367
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21064321 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21064367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 21125721 - 21125771
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21125721 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatcc |
21125771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 27341589 - 27341543
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27341589 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
27341543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 28346764 - 28346710
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28346764 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 33526418 - 33526364
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33526418 |
attttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
33526364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 43477165 - 43477211
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43477165 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
43477211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 6146518 - 6146571
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
6146518 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttg |
6146571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 156 - 217
Target Start/End: Original strand, 16643657 - 16643718
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||| |||||| ||| |||| |
|
|
| T |
16643657 |
tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
16643718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 24955015 - 24954962
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24955015 |
ttttaggctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
24954962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 33652193 - 33652238
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagtttta |
33652238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 8094849 - 8094793
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8094849 |
atattctaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
8094793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 1526170 - 1526115
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
1526170 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 4710223 - 4710172
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
4710223 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4710172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 16644042 - 16643987
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
16644042 |
ctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggt |
16643987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 19494121 - 19494252
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| | | |||| |||||||||||||||||||||| |
|
|
| T |
19494121 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt--aaaaaaatatttgtttttggtccctgcaaaattttttggttt |
19494218 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19494219 |
tgaaaatagtccctgaccccacttttgtgatgat |
19494252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 156 - 215
Target Start/End: Complemental strand, 20278061 - 20278002
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
20278061 |
tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttg |
20278002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 156 - 215
Target Start/End: Complemental strand, 21064688 - 21064629
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
21064688 |
tttaggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttg |
21064629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 33636324 - 33636456
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
33636324 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggt-aaaaaaaaattttgtttttggtccctgcaaaattttttgtttt |
33636422 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33636423 |
tgaaaatagtccctgaccccacttttgtgatgat |
33636456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1163272 - 1163226
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
1163272 |
ctaaaatatggttttagtccatgcaaatatgccccgttttagtttta |
1163226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1408007 - 1408053
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
1408007 |
ctaaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
1408053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 2728595 - 2728549
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
2728595 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2728549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 3511900 - 3511954
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
3511900 |
attttaggctaaaatatggttttggtcccttcaaatatgcctcgttttggtttta |
3511954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4017298 - 4017252
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
4017298 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
4017252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6146947 - 6146901
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
6146947 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
6146901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 7272422 - 7272468
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
7272422 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
7272468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 7272749 - 7272703
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
7272749 |
ctaaaatatggttttagcccctgcaaatatgcctcgttttggtttta |
7272703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 7326419 - 7326373
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
7326419 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
7326373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11976375 - 11976421
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
11976375 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
11976421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14238753 - 14238799
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
14238753 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14238799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16789077 - 16789123
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
16789077 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
16789123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18549203 - 18549249
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
18549203 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
18549249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24090486 - 24090440
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24090486 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24090440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25131113 - 25131159
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
25131113 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
25131159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 25131445 - 25131399
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
25131445 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
25131399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28346396 - 28346442
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28346396 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28346442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28497257 - 28497303
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28497257 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttagtttta |
28497303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 29158356 - 29158402
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
29158356 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29158402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29488108 - 29488062
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
29488108 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
29488062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 32726269 - 32726223
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
32726269 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
32726223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 34963302 - 34963348
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
34963302 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
34963348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35097690 - 35097644
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35097690 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35097644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 37536088 - 37536134
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
37536088 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
37536134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40066818 - 40066772
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
40066818 |
ctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
40066772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40844158 - 40844204
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40844158 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
40844204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 42132866 - 42132916
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
42132866 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatcc |
42132916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 10337114 - 10337167
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
10337114 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10337167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 25702507 - 25702560
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
25702507 |
ttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttaatttta |
25702560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 29991918 - 29991963
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagtttta |
29991963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 3512270 - 3512218
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
3512270 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3512218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 4376014 - 4375970
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4376014 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcgttt |
4375970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 13155255 - 13155199
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||| ||||||||||||||| || |||||||||||| |||||||| |||||||||| |
|
|
| T |
13155255 |
tttaggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatcc |
13155199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 1162911 - 1162950
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1162911 |
ctaaaatatggttttagtccctgcaaatatgcttcgtttt |
1162950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 6469277 - 6469328
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
6469277 |
ttaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggtttta |
6469328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 8094481 - 8094536
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
8094481 |
ctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggt |
8094536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 9175378 - 9175323
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
9175378 |
tattttaggttaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
9175323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 10873287 - 10873232
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| | ||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
10873287 |
tatttttggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
10873232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14495388 - 14495342
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
14495388 |
ctaaaatatggtnttagtccccgcaaatatgcctcgttttggtttta |
14495342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 22650466 - 22650505
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22650466 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
22650505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 26530673 - 26530716
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
26530673 |
aaatatggttttagtccatgcaaatatgcctcattttagtttta |
26530716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 38930304 - 38930435
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| |||||| | | |||| |||||||||||||||||||||| |
|
|
| T |
38930304 |
ctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggt--aaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
38930401 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38930402 |
tgaaaatagtccctgaccccacttttgtgatgat |
38930435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 40493155 - 40493116
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40493155 |
ctaaaatgtggttttagtccctgcaaatatgcctcgtttt |
40493116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1778566 - 1778612
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
1778566 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1778612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4474042 - 4473996
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4474042 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
4473996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4621352 - 4621306
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
4621352 |
ctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
4621306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5357425 - 5357471
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5357425 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
5357471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 7186002 - 7185956
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
7186002 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7185956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 7326088 - 7326134
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
7326088 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggtttta |
7326134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 7420232 - 7420278
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
7420232 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
7420278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 7420588 - 7420542
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
7420588 |
ctaaaatatggttttggtcactgcaaatatgcctcgttttggtttta |
7420542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8298589 - 8298635
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
8298589 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 8298973 - 8298927
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
8298973 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8298927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9496343 - 9496389
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
9496343 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
9496389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9496721 - 9496675
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
9496721 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
9496675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10540780 - 10540734
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
10540780 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
10540734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 10872917 - 10872963
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
10872917 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
10872963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11019522 - 11019568
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
11019522 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11019568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13232560 - 13232514
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
13232560 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
13232514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13779530 - 13779484
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
13779530 |
ctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
13779484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14488718 - 14488764
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
14488718 |
ctaaaatatagttttagtccctgaaaatatgcctcgttttggtttta |
14488764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14489071 - 14489025
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
14489071 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14489025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14496818 - 14496864
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
14496818 |
ctaaaatatggttttagttcctgcaaatatgcgtcgttttggtttta |
14496864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 15719658 - 15719704
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
15719658 |
ctaaaatatggttttagtccctgcaaatatatctcgttttggtttta |
15719704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18549571 - 18549525
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggtttta |
18549525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19962997 - 19963043
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
19962997 |
ctaaaatatggtgttagtccttgcaaatatgtctcgttttagtttta |
19963043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 20984148 - 20984194
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20984148 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
20984194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 23939549 - 23939595
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
23939549 |
ctaaaatatggttttggtcactgcaaatatgtctcgttttagtttta |
23939595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24187571 - 24187617
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
24187571 |
ctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
24187617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24187895 - 24187849
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24187895 |
ctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
24187849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25600232 - 25600278
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
25600232 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25600278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28323851 - 28323897
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
28323851 |
ctaaaatatggttgtagtccctgcaaatatgcttcgttttggtttta |
28323897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 196
Target Start/End: Original strand, 28398758 - 28398792
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398758 |
ctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 32725909 - 32725955
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
32725909 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
32725955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 33526054 - 33526100
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
33526054 |
ctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
33526100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 34963662 - 34963616
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
34963662 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
34963616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35097330 - 35097376
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35097330 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35097376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35346631 - 35346677
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35346631 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35346996 - 35346950
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35346996 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35346950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 37536417 - 37536371
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
37536417 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37536371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40492962 - 40493008
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
40492962 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggtttta |
40493008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 42133152 - 42133106
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
42133152 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42133106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 11976733 - 11976688
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
11976688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 13232201 - 13232246
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13232246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 165 - 214
Target Start/End: Original strand, 24814710 - 24814759
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagttttaatcctt |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcctt |
24814759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 27117974 - 27117929
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
27117974 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 28497616 - 28497571
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
28497571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 29158667 - 29158614
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
29158667 |
ctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttg |
29158614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 35115637 - 35115592
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
35115637 |
ctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 36044790 - 36044741
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||||||||||| |||||||||||| || |||||||| ||||||||| |
|
|
| T |
36044790 |
ctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatc |
36044741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 40844532 - 40844487
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggtttta |
40844487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 42430118 - 42430065
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |||||| |
|
|
| T |
42430118 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttg |
42430065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 43727431 - 43727379
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccttg |
43727379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 1525911 - 1525943
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1525911 |
gaaaatagtccctgaccccacttttgtgatgat |
1525943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 4375791 - 4375823
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4375791 |
gaaaatagtccctgaccccacttttgtgatgat |
4375823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 6146847 - 6146815
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6146847 |
gaaaatagtccctgaccccacttttgtgatgat |
6146815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 10540445 - 10540497
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||| ||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
10540445 |
tttaggctaaaatattgttttggtctctgcaaatatgcctcgttttggtttta |
10540497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 14495299 - 14495267
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14495299 |
gaaaatagtccctgaccccacttttgtgatgat |
14495267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 21509796 - 21509828
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21509796 |
gaaaatagtccctgaccccacttttgtgatgat |
21509828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 195
Target Start/End: Complemental strand, 21509923 - 21509883
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcct |
195 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
21509923 |
ttttaggctaaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 22917826 - 22917794
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22917826 |
gaaaatagtccctgaccccacttttgtgatgat |
22917794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 24954910 - 24954878
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
24954910 |
gaaaatagtccctgaccccacttttgtgatgat |
24954878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 27117746 - 27117794
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27117746 |
tattttaggctaaaatatggttttgctccctgcaaatatgtctcgtttt |
27117794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 30337215 - 30337171
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
30337215 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 40493054 - 40493086
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40493054 |
gaaaatagtccctgaccccacttttgtgatgat |
40493086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 44997933 - 44997981
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
44997933 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaat |
44997981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 295
Target Start/End: Original strand, 4017005 - 4017036
Alignment:
| Q |
264 |
aaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4017005 |
aaaatagtccctgaccccacttttgtgatgat |
4017036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 4473701 - 4473752
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| | |||||||| |||||| |
|
|
| T |
4473701 |
ttaggctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
4473752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 193
Target Start/End: Original strand, 43727097 - 43727128
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgc |
43727128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2728234 - 2728280
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
2728234 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
2728280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5357761 - 5357715
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
5357761 |
ctaaaatatgattttggtccctgcaaatatgcttcgttttggtttta |
5357715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 17073809 - 17073855
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
17073809 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17073855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 17574461 - 17574415
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
17574461 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
17574415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 20984508 - 20984462
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||| |||||| |
|
|
| T |
20984508 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
20984462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 28399033 - 28398987
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28399033 |
ctaaaatatgattttagtccctgcaaatatggttcgttttggtttta |
28398987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 196
Target Start/End: Complemental strand, 30969715 - 30969681
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctc |
196 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30969715 |
ctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35143842 - 35143796
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||| |||||| |
|
|
| T |
35143842 |
ctaaaatatggttttaatccgtgtaaatatgcctcgttttggtttta |
35143796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 2811778 - 2811733
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2811733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 3680799 - 3680754
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
3680799 |
ctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 25702807 - 25702762
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| |||| |
|
|
| T |
25702807 |
ctaaaatatggttttggtccctgcaaatatgtctcattttaatttt |
25702762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 32040070 - 32040123
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||||||| ||||||| |||||| |
|
|
| T |
32040070 |
ttttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggtttta |
32040123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 1163013 - 1163045
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1163013 |
gaaaatagtctctgaccccacttttgtgatgat |
1163045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 1408253 - 1408221
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1408253 |
gaaaatagtcactgaccccacttttgtgatgat |
1408221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 1778917 - 1778877
Alignment:
| Q |
172 |
gttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatcc |
1778877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 6146616 - 6146648
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
6146616 |
gaaaatagttcctgaccccacttttgtgatgat |
6146648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 8094581 - 8094613
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
8094581 |
gaaaatagtccctgaccccatttttgtgatgat |
8094613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 10776397 - 10776365
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
10776397 |
gaaaatagtccttgaccccacttttgtgatgat |
10776365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 14488816 - 14488848
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
14488816 |
gaaaatagtccctgaccccatttttgtgatgat |
14488848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 267 - 295
Target Start/End: Complemental strand, 16789268 - 16789240
Alignment:
| Q |
267 |
atagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16789268 |
atagtccctgaccccacttttgtgatgat |
16789240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 22650568 - 22650600
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
22650568 |
gaaaatagtccctggccccacttttgtgatgat |
22650600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 24187668 - 24187700
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
24187668 |
gaaaatagtctctgaccccacttttgtgatgat |
24187700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 25131210 - 25131242
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
25131210 |
gaaaatagtccctgaccccacttttatgatgat |
25131242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 28398938 - 28398906
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28398938 |
gaaaatagtccctaaccccacttttgtgatgat |
28398906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 29992295 - 29992259
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29992295 |
aaatatggttttgttccctgcaaatatgcctcgtttt |
29992259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 30337023 - 30337055
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
30337023 |
gaaaatagtccctgaccccatttttgtgatgat |
30337055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 32040272 - 32040240
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
32040272 |
gaaaatagtctctgaccccacttttgtgatgat |
32040240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 5e-19; HSPs: 214)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 31869964 - 31869908
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31869964 |
atattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
31869908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 156 - 215
Target Start/End: Complemental strand, 3830520 - 3830461
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
3830520 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
3830461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 39437107 - 39436975
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
39437107 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt-aaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
39437009 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39437008 |
tgaaaatagtccctgaccccacttttgtgatgat |
39436975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 3151744 - 3151798
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3151744 |
attttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3151798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 3152115 - 3152054
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
3152115 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
3152054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 21159822 - 21159769
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21159822 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
21159769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 34238595 - 34238655
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
34238595 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggt |
34238655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 4513256 - 4513311
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4513256 |
tatttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4513311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 10976980 - 10977035
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
10976980 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
10977035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 20612896 - 20612841
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
20612896 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
20612841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 22156291 - 22156236
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
22156291 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 28427606 - 28427551
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
28427606 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
28427551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 29525107 - 29525158
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
29525107 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcct |
29525158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 37506869 - 37506924
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
37506869 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37506924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 51834610 - 51834665
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
51834610 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
51834665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4035051 - 4035005
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4035051 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
4035005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4950039 - 4950085
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4950039 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4950085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14633547 - 14633593
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14633593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21553891 - 21553937
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21553891 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
21553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 155 - 295
Target Start/End: Original strand, 22155924 - 22156063
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnn |
254 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| ||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
22155924 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt-aaaaaaaaaatttgtttttggtccctgcaaaatttt |
22156022 |
T |
 |
| Q |
255 |
nnnnnnnngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22156023 |
ttgtttttgaaaatagtccctgaccccacttttgtgatgat |
22156063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 25710868 - 25710822
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25710868 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25710822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 29955672 - 29955618
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29955672 |
attttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29955618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 30004827 - 30004773
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30004827 |
attttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30004773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 37507220 - 37507174
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37507220 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37507174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 45006247 - 45006197
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatcc |
45006197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 50196301 - 50196347
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
50196347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 155 - 217
Target Start/End: Complemental strand, 51834947 - 51834885
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
51834947 |
ttttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
51834885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 2486900 - 2486847
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttg |
2486847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 7518092 - 7518145
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
7518092 |
ctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttg |
7518145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 39288902 - 39288841
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
39288902 |
tttaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
39288841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 40545559 - 40545612
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40545559 |
ttttaggctaaaatatggttttggtccctgcaaatatgactcgttttagtttta |
40545612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 46751273 - 46751326
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
46751273 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttg |
46751326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 154 - 211
Target Start/End: Original strand, 52342189 - 52342246
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||| |||| ||||||||| |
|
|
| T |
52342189 |
attttaggctaaaatatggttttggtccctgcaaatatgcctccttttggttttaatc |
52342246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 215
Target Start/End: Complemental strand, 47005524 - 47005464
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
47005524 |
ttttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttg |
47005464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 3830131 - 3830182
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
3830131 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
3830182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 8510216 - 8510348
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
8510216 |
ctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaa-tttgtttttggtccctgcaaaattttttgtttt |
8510314 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
8510315 |
tgaaaatagtctctgaccccacttttgtgatgat |
8510348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 13584365 - 13584310
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| ||| |||| |
|
|
| T |
13584365 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 22008515 - 22008574
Alignment:
| Q |
149 |
caaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
22008515 |
caaaaatttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22008574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 22016033 - 22016092
Alignment:
| Q |
149 |
caaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
22016033 |
caaaaatttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22016092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 26799890 - 26799945
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||| ||| |||| |
|
|
| T |
26799890 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
26799945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 28552386 - 28552335
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28552386 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
28552335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 28942903 - 28942848
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
28942903 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 29955300 - 29955339
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
29955339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 30004454 - 30004493
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
30004493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 34238913 - 34238858
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| |||||| |||||||| |
|
|
| T |
34238913 |
ctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtccttggt |
34238858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 39436720 - 39436775
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
39436720 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
39436775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3361816 - 3361770
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
3361816 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
3361770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4814542 - 4814588
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4814542 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5345687 - 5345641
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
5345687 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
5345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9262153 - 9262107
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
9262153 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9262107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9863402 - 9863356
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
9863402 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
9863356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 15016390 - 15016436
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
15016390 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
15016436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16123141 - 16123187
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
16123141 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
16123187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 20611022 - 20611068
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
20611022 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
20611068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 22008888 - 22008842
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
22008888 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
22008842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25615977 - 25616023
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
25615977 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25616023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28552023 - 28552069
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28552023 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
28552069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28942527 - 28942573
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
28942527 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
28942573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 29445956 - 29446002
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29445956 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29446002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30130160 - 30130206
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
30130160 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
30130206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30268507 - 30268553
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30268507 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
30268553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30424630 - 30424676
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
30424630 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttagtttta |
30424676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31480138 - 31480184
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
31480138 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
31480184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 39072211 - 39072161
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
39072211 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatcc |
39072161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 39288575 - 39288621
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
39288575 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39288621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40370587 - 40370541
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
40370587 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40370541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 40979708 - 40979658
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
40979708 |
ctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatcc |
40979658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 43440497 - 43440543
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
43440497 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
43440543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44802284 - 44802330
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
44802284 |
ctaaaatatggttttagtccctgcaaatatgcgtcgttttggtttta |
44802330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 45002023 - 45002069
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
45002023 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45002069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45320977 - 45320931
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45320977 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
45320931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46186769 - 46186723
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
46186769 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
46186723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 47005156 - 47005202
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
47005156 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
47005202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 49323784 - 49323830
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
49323784 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
49323830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 50196655 - 50196609
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
50196655 |
ctaaaatatggttttagtccctacaaatatgcctcgtttttgtttta |
50196609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 51500683 - 51500637
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
51500683 |
ctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51500637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 51550084 - 51550130
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
51550084 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
51550130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 51760116 - 51760070
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
51760116 |
ctaaaatatggttctagtccctgcaaatatgcctcgttttggtttta |
51760070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 53701661 - 53701615
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
53701661 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
53701615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 54608520 - 54608566
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
54608520 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
54608566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 8940522 - 8940477
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8940477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 12740902 - 12740955
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
12740902 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12740955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 19656543 - 19656596
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| |||||| |
|
|
| T |
19656543 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttg |
19656596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 20757403 - 20757448
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
20757448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 21159455 - 21159508
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
21159455 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttg |
21159508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 25610128 - 25610075
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
25610128 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttg |
25610075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 29446204 - 29446151
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |||||| |
|
|
| T |
29446204 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttg |
29446151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 30034109 - 30034162
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttg |
30034162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 46186411 - 46186464
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
46186411 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttg |
46186464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 51550451 - 51550398
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
51550451 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
51550398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 9603927 - 9603871
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
9603927 |
atattataggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 30128276 - 30128332
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| ||| |||||||| |||||| |
|
|
| T |
30128276 |
atattttaggctaaaatatggttttggtccctgcaaacatgtctcgttttggtttta |
30128332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 47336220 - 47336276
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| || ||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
47336220 |
atatttaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
47336276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 275446 - 275485
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
275446 |
ctaaaatatggttttagtccctgcaactatgcctcgtttt |
275485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 863274 - 863329
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| |||||||||| |||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
863274 |
tattttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagtttta |
863329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 4513627 - 4513572
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| || |||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
4513627 |
tatttaaggctaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
4513572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 7518449 - 7518398
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
7518449 |
ttagactaaaatatggttttactccctgcaaatatgtctcgttttggtttta |
7518398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 10977339 - 10977284
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
10977339 |
ctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 201
Target Start/End: Original strand, 25353205 - 25353240
Alignment:
| Q |
166 |
aatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25353205 |
aatatggttttagtccctgcaaatatgcctcgtttt |
25353240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 28427247 - 28427302
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
28427247 |
ctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 32119217 - 32119268
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
32119217 |
ttaggctaaaatatagttttggtccctgcaaatatgtctcgttttagtttta |
32119268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 40169652 - 40169613
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40169652 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
40169613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 474046 - 474092
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
474046 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 474406 - 474360
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
474406 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
474360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1721450 - 1721404
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
1721450 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
1721404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3387602 - 3387556
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
3387602 |
ctaaaatatggttttggtcgctgcaaatatgcctcgttttggtttta |
3387556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4034719 - 4034765
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
4034719 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4034765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9261791 - 9261837
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
9261791 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
9261837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9603631 - 9603677
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
9603631 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
9603677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11463234 - 11463280
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
11463234 |
ctaaaatatggttttggttcctgcaaatatgcctcgttttggtttta |
11463280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12673646 - 12673692
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
12673646 |
ctaaaatatagttttagtccctgtaaatatgcctcgttttggtttta |
12673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 12741269 - 12741223
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
12741269 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12741223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14772213 - 14772259
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
14772213 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14772259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 15286158 - 15286204
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
15286158 |
ctaaaatatggttttaatccctgcaaatatgcttcgttttggtttta |
15286204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 15979340 - 15979386
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
15979340 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
15979386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19844267 - 19844313
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| ||||| |
|
|
| T |
19844267 |
ctaaaatatggttttggtccctacaaatatgcctcgttttaatttta |
19844313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 19844579 - 19844533
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
19844579 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
19844533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26089732 - 26089778
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
26089732 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
26089778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 26090076 - 26090030
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
26090076 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
26090030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 27681680 - 27681630
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
27681680 |
ctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatcc |
27681630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29490741 - 29490695
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
29490741 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29490695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 30106218 - 30106172
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
30106218 |
ctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
30106172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 31480498 - 31480452
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
31480498 |
ctaaaatatggatttggtccctgcaaatatgcctcgttttggtttta |
31480452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 32119582 - 32119536
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
32119582 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
32119536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40370287 - 40370333
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
40370287 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttagtttta |
40370333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 43440785 - 43440739
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggtttta |
43440739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 43441272 - 43441318
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
43441272 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43441318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 43441601 - 43441555
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
43441601 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
43441555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45002383 - 45002337
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
45002383 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
45002337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 47336579 - 47336533
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
47336579 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47336533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 48924238 - 48924192
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
48924238 |
ctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
48924192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 52342581 - 52342535
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
52342581 |
ctaaaatatggtttttgtctctgcaaatatgcctcgttttggtttta |
52342535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 54608861 - 54608815
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
54608861 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54608815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 9863050 - 9863094
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgc-aatatgcctcgttttggtttta |
9863094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 199
Target Start/End: Original strand, 18175793 - 18175830
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18175793 |
ctaaaatatggttttagtccctgcaaatatgtctcgtt |
18175830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 20907454 - 20907409
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggtttta |
20907409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 35569133 - 35569088
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35569088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 45161116 - 45161161
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggtttta |
45161161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 275543 - 275575
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
275543 |
gaaaatagtccctgaccccacttttgtgatgat |
275575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 8555305 - 8555253
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||| |||||| |||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttg |
8555253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 10977079 - 10977111
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10977079 |
gaaaatagtccctgaccccacttttgtgatgat |
10977111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 13584105 - 13584137
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13584105 |
gaaaatagtccctgaccccacttttgtgatgat |
13584137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 15979705 - 15979653
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||| |||||||| |||||||| |||||| |
|
|
| T |
15979705 |
tttaggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
15979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 208
Target Start/End: Original strand, 16679676 - 16679724
Alignment:
| Q |
160 |
gtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| ||||||| |||||| |
|
|
| T |
16679676 |
gtctaaaatatggttttagtccttgaaaatatgcttcgttttggtttta |
16679724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 19656802 - 19656770
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19656802 |
gaaaatagtccctgaccccacttttgtgatgat |
19656770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 20907356 - 20907324
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20907356 |
gaaaatagtccctgaccccacttttgtgatgat |
20907324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 201
Target Start/End: Original strand, 25710515 - 25710551
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgtttt |
25710551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 198
Target Start/End: Complemental strand, 26273822 - 26273786
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgt |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26273822 |
ctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 28452142 - 28452202
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||||| || ||||| |||||| |||||| |
|
|
| T |
28452142 |
ttttaggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttg |
28452202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 29955400 - 29955432
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29955400 |
gaaaatagtccctgaccccacttttgtgatgat |
29955432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 30004554 - 30004586
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30004554 |
gaaaatagtccctgaccccacttttgtgatgat |
30004586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 37506968 - 37507000
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37506968 |
gaaaatagtccctgaccccacttttgtgatgat |
37507000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 39288798 - 39288766
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39288798 |
gaaaatagtccctgaccccacttttgtgatgat |
39288766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 40169552 - 40169520
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40169552 |
gaaaatagtccctgaccccacttttgtgatgat |
40169520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 45320879 - 45320847
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45320879 |
gaaaatagtccctgaccccacttttgtgatgat |
45320847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 49670801 - 49670745
Alignment:
| Q |
162 |
ctaaaatatggttttagtccc-tgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
49670801 |
ctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt |
49670745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 53701353 - 53701409
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| | |||||||||||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
53701353 |
atatttttggctaaaatatggttttaatctctgcaaatatgccttattttagtttta |
53701409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 166 - 217
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
| Q |
166 |
aatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 14633887 - 14633832
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || ||||| |||||| ||| |||| |
|
|
| T |
14633887 |
ctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
14633832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 20405226 - 20405175
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| | | |||||||||||| |
|
|
| T |
20405226 |
ttaggctaaaatatggttttggtccctgcaaatatactttgttttagtttta |
20405175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 28452379 - 28452328
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||||| ||||||| |||||| |
|
|
| T |
28452379 |
ttaggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
28452328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 30130499 - 30130456
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
30130499 |
aaatatggttttagtcactgcaaatatgcctcattttggtttta |
30130456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 30426224 - 30426186
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30426224 |
ctaaaatatggttttagtcc-tgcaaatatgcctcgtttt |
30426186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 40169346 - 40169385
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
40169346 |
ctaaaatatggttttaatccctgcaaatatgtctcgtttt |
40169385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 45313861 - 45313822
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
45313861 |
ctaaaatatggttttggtccctgcaaatatgcttcgtttt |
45313822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 53113445 - 53113484
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
53113445 |
ctaaaatatggttttggtccctgcaaatatgtctcgtttt |
53113484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 53632506 - 53632557
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcctt |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
53632506 |
taaaatatggttttagtccctataaatatggttcgttttagttttagtcctt |
53632557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 275831 - 275785
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
275831 |
ctaaaatatgattttagtccctgtaaatatgcttcgttttggtttta |
275785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2486581 - 2486627
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggtttta |
2486627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4814896 - 4814851
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
4814896 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggtttta |
4814851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 7588320 - 7588366
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
7588320 |
ctaaaatatagttttggtccctgcaaatatgccttgttttggtttta |
7588366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 7957224 - 7957178
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
7957224 |
ctaaaatatgattttggtccctgcaaatatgcgtcgttttggtttta |
7957178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9596760 - 9596806
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| ||||||| |||||| |
|
|
| T |
9596760 |
ctaaaatatggtttttgtctctgcaaatatgcatcgttttggtttta |
9596806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9597093 - 9597047
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
9597093 |
ctaaaatatggttttgttccctgcaaatatgcttcgttttggtttta |
9597047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 10778373 - 10778411
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgtttt |
10778411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 192
Target Start/End: Complemental strand, 26800167 - 26800137
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26800167 |
ctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31869596 - 31869642
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggtttta |
31869642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35177257 - 35177303
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35177257 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
35177303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 35498418 - 35498468
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
35498418 |
ctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatcc |
35498468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35565510 - 35565556
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
35565510 |
ctaaaatatggttttgttccctgcaaatatacctcgttttggtttta |
35565556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 35936782 - 35936832
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||||| ||||||| | ||||||| |||||||||| |
|
|
| T |
35936782 |
ctaaaatatggttttggtccctacaaatatacttcgttttggttttaatcc |
35936832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40277824 - 40277870
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
40277824 |
ctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 46901106 - 46901152
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
46901106 |
ctaaaatatggttttagtctctgcaaatatgtatcgttttggtttta |
46901152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 47114489 - 47114535
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
47114489 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
47114535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 50009282 - 50009232
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||| ||||||||| |
|
|
| T |
50009282 |
ctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatcc |
50009232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 51500400 - 51500446
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||||||||| |||||| |
|
|
| T |
51500400 |
ctaaaatatggttctagtctctgtaaatatgcctcgttttggtttta |
51500446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 51759821 - 51759867
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |||||||| |||||| |
|
|
| T |
51759821 |
ctaaaatatggttctagttcctgcaaatatgtctcgttttggtttta |
51759867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 3387268 - 3387313
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
3387313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 12673978 - 12673933
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||| |||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggtttta |
12673933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 20757500 - 20757529
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20757500 |
gaaaatagtccctgaccccacttttgtgat |
20757529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 27200441 - 27200486
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
27200441 |
taaaatatggttttaatccctgcaaatatatctcattttagtttta |
27200486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 38232243 - 38232296
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
38232243 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttg |
38232296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Complemental strand, 39072112 - 39072083
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39072112 |
gaaaatagtccctgaccccacttttgtgat |
39072083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 39132911 - 39132874
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatg |
192 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
39132911 |
ttttaggctaaaatatggttttggtccctgcaaatatg |
39132874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 191
Target Start/End: Original strand, 39819314 - 39819343
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 40723121 - 40723166
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||| |||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggtttta |
40723166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 191
Target Start/End: Original strand, 44506584 - 44506613
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44506584 |
ctaaaatatggttttagtccctgcaaatat |
44506613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 47901803 - 47901848
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||| |||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggtttta |
47901848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 49324143 - 49324098
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||| |||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
49324098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 3152010 - 3151978
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
3152010 |
gaaaatagtctctgaccccacttttgtgatgat |
3151978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 3830232 - 3830264
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
3830232 |
gaaaatagtccctgaccccatttttgtgatgat |
3830264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 4950266 - 4950234
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
4950266 |
gaaaataggccctgaccccacttttgtgatgat |
4950234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 10778631 - 10778599
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
10778631 |
gaaaatagtccctgaccctacttttgtgatgat |
10778599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 12673904 - 12673872
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
12673904 |
gaaaatagtctctgaccccacttttgtgatgat |
12673872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 13514581 - 13514529
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||| |||| || |||||||||||| |||||||| |||||| |
|
|
| T |
13514581 |
tttaggctaaaatatgattttggtacctgcaaatatgtctcgttttggtttta |
13514529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 16123242 - 16123274
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
16123242 |
gaaaatagtctctgaccccacttttgtgatgat |
16123274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 191
Target Start/End: Original strand, 20807800 - 20807828
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatat |
20807828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 21159715 - 21159683
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
21159715 |
gaaaatagtccctgacaccacttttgtgatgat |
21159683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 26799990 - 26800022
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
26799990 |
gaaaatagtccttgaccccacttttgtgatgat |
26800022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 28427507 - 28427475
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
28427507 |
gaaaatagtctctgaccccacttttgtgatgat |
28427475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 45161213 - 45161245
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
45161213 |
gaaaatagtccctgacaccacttttgtgatgat |
45161245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 46186669 - 46186637
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
46186669 |
gaaaatagtccctgaccccatttttgtgatgat |
46186637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 47901901 - 47901933
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
47901901 |
gaaaatagtccctgactccacttttgtgatgat |
47901933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 51834841 - 51834809
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
51834841 |
gaaaatagtccctgaccccactattgtgatgat |
51834809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 197)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 155 - 215
Target Start/End: Complemental strand, 35005749 - 35005689
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
35005749 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
35005689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 7001895 - 7001763
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
7001895 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt-aaaaaaataatttgtttttggtccctgcaaaattttttgtttt |
7001797 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7001796 |
tgaaaatagtccctgaccccacttttgtgatgat |
7001763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 156 - 215
Target Start/End: Complemental strand, 22919981 - 22919922
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22919981 |
tttaggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttg |
22919922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 11822006 - 11822059
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
11822006 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
11822059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 145 - 295
Target Start/End: Original strand, 18473257 - 18473405
Alignment:
| Q |
145 |
ttatcaaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccct |
244 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| ||||||||||||||| |
|
|
| T |
18473257 |
ttattaaatataataggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccct |
18473354 |
T |
 |
| Q |
245 |
gcaaaannnnnnnnnnnngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18473355 |
gcaaaattttttgtttttgaaaatagtccctgaccccacttttgtgatgat |
18473405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 157 - 217
Target Start/End: Complemental strand, 990382 - 990322
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
990382 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
990322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 45290827 - 45290763
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||| |||||| ||| |||| |
|
|
| T |
45290827 |
tattttaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 21391089 - 21391144
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
21391089 |
tattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
21391144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 26061958 - 26062013
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
26061958 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26062013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 31258341 - 31258473
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
31258341 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt-aaaaaaataatttgtttttggtccctgcaaaattttttgtttt |
31258439 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31258440 |
tgaaaatagtccctgaccccacttttgtgatgat |
31258473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 154 - 217
Target Start/End: Complemental strand, 31258708 - 31258645
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
31258708 |
attttagcttaaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 32729047 - 32728992
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
32729047 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
32728992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 41358371 - 41358426
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
41358371 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1810929 - 1810975
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1810929 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
1810975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3753215 - 3753261
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3753215 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3753261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13770491 - 13770537
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13770491 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13770537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18302385 - 18302339
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18302385 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18302339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18473593 - 18473547
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18473593 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18473547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 22919686 - 22919732
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22919686 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
22919732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24649352 - 24649398
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24649352 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24649398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 29072499 - 29072545
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29072499 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29072545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 33379890 - 33379936
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33379890 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33379936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35307717 - 35307763
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35307717 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35307763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35308109 - 35308063
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35308109 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35308063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44641080 - 44641126
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44641080 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44641126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 45368492 - 45368538
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45368492 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45368538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 7867124 - 7867177
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7867124 |
ttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
7867177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 19622650 - 19622703
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
19622650 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19622703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 21391371 - 21391326
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagtttta |
21391326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 26191361 - 26191414
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
26191361 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttg |
26191414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 26191732 - 26191679
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
26191732 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
26191679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 52254185 - 52254238
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
52254185 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttg |
52254238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 32454297 - 32454253
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32454297 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
32454253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 50429213 - 50429161
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50429213 |
tttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
50429161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 52254486 - 52254438
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52254486 |
tatttttggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
52254438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 990090 - 990145
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| ||| |||| |
|
|
| T |
990090 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggt |
990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 4323830 - 4323869
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4323830 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
4323869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 13260324 - 13260273
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
13260324 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13260273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 17130081 - 17130030
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatcct |
17130030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 18079658 - 18079619
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18079658 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
18079619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 19623015 - 19622960
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
19623015 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 35005446 - 35005485
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005446 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
35005485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 41358661 - 41358530
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| | | |||| |||||||||||||||||||||| |
|
|
| T |
41358661 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt--aaaaaaatatttgtttttggtccctgcaaaattttttggttt |
41358564 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41358563 |
tgaaaatagtccctgaccccacttttgtgatgat |
41358530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 45290459 - 45290514
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
45290459 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
45290514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 48609597 - 48609546
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
48609597 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48609546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3679628 - 3679674
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3679628 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
3679674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3753570 - 3753524
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
3753570 |
ctaaaatatggttttagtccctgtaaatatgcctcgttttggtttta |
3753524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6567494 - 6567448
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6567494 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
6567448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 7818784 - 7818830
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7818784 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
7818830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 12322968 - 12322918
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||||||| |
|
|
| T |
12322968 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatcc |
12322918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12360605 - 12360651
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
12360605 |
ctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
12360651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12361013 - 12361059
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
12361013 |
ctaaaatatggttttagtccctgcaaatttgcctcgttttggtttta |
12361059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14007491 - 14007537
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
14007491 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
14007537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 15516576 - 15516630
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
15516576 |
attttaggctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
15516630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 17984335 - 17984381
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
17984335 |
ctaaaatatggtttgagtccctgcaaatatgcctcgttttggtttta |
17984381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 17984699 - 17984653
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17984699 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
17984653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 22953554 - 22953508
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
22953554 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22953508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24507841 - 24507795
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24507841 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24507795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24653804 - 24653850
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24653804 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24653850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26442565 - 26442611
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
26442565 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26442611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 26442897 - 26442851
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
26442897 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
26442851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29072860 - 29072814
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
29072860 |
ctaaaatatggttttagtccctgcaaatatgcctcgctttggtttta |
29072814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29688426 - 29688380
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
29688426 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
29688380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 32626531 - 32626577
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32626531 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
32626577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 33045688 - 33045642
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
33045688 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
33045642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 37545630 - 37545676
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
37545630 |
ctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
37545676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 38151210 - 38151164
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38151210 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38151164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 38164293 - 38164247
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38164293 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38164247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 41738798 - 41738844
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
41738798 |
ctaaaatatggttttggtccctgcaaatatgcctcattttagtttta |
41738844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44157697 - 44157743
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
44157697 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
44157743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44641430 - 44641384
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44641430 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
44641384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 47819234 - 47819280
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
47819234 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 47819594 - 47819548
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
47819594 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
47819548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 48955716 - 48955762
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48955716 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
48955762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 48956064 - 48956018
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
48956064 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
48956018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 50799132 - 50799178
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
50799132 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
50799178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 3247559 - 3247514
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3247514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 15058420 - 15058473
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
15058420 |
ctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttg |
15058473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 15335292 - 15335247
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
15335247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 18899842 - 18899887
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18899887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 18900130 - 18900085
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggtttta |
18900085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 24649669 - 24649612
Alignment:
| Q |
151 |
aatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||| | |||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
24649669 |
aataatttaggccaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
24649612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 37624748 - 37624793
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
37624748 |
ctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 38163934 - 38163979
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38163979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 45638897 - 45638844
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
45638897 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaat |
45638844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 48730615 - 48730562
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttg |
48730562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 30323297 - 30323245
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
30323297 |
tttaggctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
30323245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 33000298 - 33000346
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33000298 |
tattttcggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
33000346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 45380268 - 45380320
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
45380268 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45380320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 2939934 - 2939977
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggtttta |
2939977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 3679984 - 3679945
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3679984 |
ctaaaatatgattttagtccctgcaaatatgcctcgtttt |
3679945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 4789305 - 4789356
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
4789305 |
ttagactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4789356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 7350426 - 7350477
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcctt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||| ||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtcctt |
7350477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 8140431 - 8140482
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
8140431 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8140482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 10887601 - 10887550
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
10887601 |
ttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10887550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 11822363 - 11822324
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11822363 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
11822324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 25658007 - 25658066
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||| | ||||||||||||||| ||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
25658007 |
tatttttggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatcc |
25658066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 27521578 - 27521617
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27521578 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
27521617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 33067344 - 33067395
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
33067344 |
tttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 41881095 - 41881227
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||||| ||| |||| ||| |||||||||||||||||| |
|
|
| T |
41881095 |
ctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaat-tttatttttggtccctgcaaaaatttttgtttt |
41881193 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41881194 |
tgaaaatagtccctgaccccacttttgtgatgat |
41881227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3247200 - 3247246
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
3247200 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
3247246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 7819101 - 7819055
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
7819101 |
ctaaaatatggttttaatctctgcaaatatgcctcgttttggtttta |
7819055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 8140797 - 8140751
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |||||| |
|
|
| T |
8140797 |
ctaaaatatggttttggtacctgcaaatatgcctcgttttggtttta |
8140751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 10631166 - 10631212
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
10631166 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
10631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10631526 - 10631480
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
10631526 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
10631480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12158692 - 12158738
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
12158692 |
ctaaaatatggttttagtctctgcaaatatgcatcgttttggtttta |
12158738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 12360966 - 12360920
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
12360966 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12360920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13259990 - 13260036
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
13259990 |
ctaaaatatggttttagtcgctgcaaatatggctcgttttggtttta |
13260036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 15211856 - 15211806
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
15211856 |
ctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatcc |
15211806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 15526360 - 15526314
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
15526360 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
15526314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 16026936 - 16026890
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
16026936 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16026890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 16060883 - 16060837
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
16060883 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16060837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16083049 - 16083095
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
16083049 |
ctaaaatatggttttagtccccgcaaatatgtctcgtttttgtttta |
16083095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19720714 - 19720760
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
19720714 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19720760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24507481 - 24507527
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24507481 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24507527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24510306 - 24510260
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24510306 |
ctaaaatatggttttggtccctgcaaatatggttcgttttagtttta |
24510260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24654165 - 24654119
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
24654165 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24654119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24977780 - 24977826
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
24977780 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
24977826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26324587 - 26324633
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
26324587 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
26324633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 26324945 - 26324899
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
26324945 |
ctaaaatatgattttagtccatgcaaatatgcctcgttttggtttta |
26324899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30322931 - 30322977
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
30322931 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
30322977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 33000667 - 33000621
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
33000667 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33000621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 33234548 - 33234594
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
33234548 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
33234594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 34002938 - 34002892
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
34002938 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggtttta |
34002892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 34382949 - 34382987
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34382949 |
ctaaaatatggttttagtccctgcaaatatacctcgttt |
34382987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35056532 - 35056578
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35056532 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35056578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35056892 - 35056846
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35056892 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
35056846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 38136979 - 38136933
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38136979 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
38136933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 39303676 - 39303722
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| |||||| |
|
|
| T |
39303676 |
ctaaaatatggttttagtccctgcaagtatgtctcgttttggtttta |
39303722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 39747833 - 39747787
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
39747833 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
39747787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40718112 - 40718158
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
40718112 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
40718158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44158040 - 44157994
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
44158040 |
ctaaaatatggtttttgtccctgcaaatatgcctagttttggtttta |
44157994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45368847 - 45368801
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggtttta |
45368801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45380634 - 45380588
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
45380634 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
45380588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 45638582 - 45638628
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
45638582 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
45638628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 46183686 - 46183732
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
46183732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46868575 - 46868529
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
46868575 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
46868529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 48609238 - 48609284
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
48609238 |
ctaaaatatggttttagtcccggcaaatatgtctcgttttggtttta |
48609284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 49073693 - 49073743
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||||||| |
|
|
| T |
49073693 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatcc |
49073743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 50428875 - 50428925
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
50428875 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatcc |
50428925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 199
Target Start/End: Complemental strand, 4360624 - 4360587
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4360624 |
ctaaaatatggttttagtccctgcaaatatgtctcgtt |
4360587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 10887228 - 10887281
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
10887228 |
ttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
10887281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 19721071 - 19721026
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
19721026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 29579315 - 29579368
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||||||||| ||||| ||||| |
|
|
| T |
29579315 |
ttttagactaaaatatggtttttgtccttgcaaatatgcctcattttaatttta |
29579368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 34808200 - 34808245
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggtttta |
34808245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 38150851 - 38150896
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
38150896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 169 - 201
Target Start/End: Original strand, 292868 - 292900
Alignment:
| Q |
169 |
atggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgtttt |
292900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 990188 - 990220
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
990188 |
gaaaatagtccctgaccccacttttgtgatgat |
990220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 3679725 - 3679757
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3679725 |
gaaaatagtccctgaccccacttttgtgatgat |
3679757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 4323930 - 4323962
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4323930 |
gaaaatagtccctgaccccacttttgtgatgat |
4323962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 4324163 - 4324111
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||| ||||||| | |||||||||| |||||||| ||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggttttaatccttg |
4324111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 7350733 - 7350681
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||||| |||||| |||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttg |
7350681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 12361112 - 12361144
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12361112 |
gaaaatagtccctgaccccacttttgtgatgat |
12361144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 14007588 - 14007620
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14007588 |
gaaaatagtccctgaccccacttttgtgatgat |
14007620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 15335193 - 15335161
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15335193 |
gaaaatagtccctgaccccacttttgtgatgat |
15335161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 201
Target Start/End: Complemental strand, 16083394 - 16083358
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgtttt |
16083358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 26142412 - 26142468
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||| |||||| || | |||||||||||||||||| |||||| |
|
|
| T |
26142412 |
atattttaggctaaaatatagttttactctccgcaaatatgcctcgttttggtttta |
26142468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 26142521 - 26142553
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26142521 |
gaaaatagtccctgaccccacttttgtgatgat |
26142553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 32626792 - 32626760
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32626792 |
gaaaatagtccctgaccccacttttgtgatgat |
32626760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 33045351 - 33045403
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||| ||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
33045351 |
tttaggctaaaatttggttttggtccctgcaaatatgcctagttttggtttta |
33045403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 26142670 - 26142631
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
26142670 |
ctaaaatatggttttaatccctgcaaatatgcctcatttt |
26142631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 33234910 - 33234871
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33234910 |
ctaaaatatgattttggtccctgcaaatatgcctcgtttt |
33234871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 36912855 - 36912894
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
36912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgtttt |
36912894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4565334 - 4565288
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| | ||||||||||||||| ||||||||| ||||| |
|
|
| T |
4565334 |
ctaaaatatggttctggtccctgcaaatatgtctcgttttaatttta |
4565288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 5058989 - 5058951
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgtttt |
5058951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14007873 - 14007827
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||| || | ||||||||||||||||||||||| |
|
|
| T |
14007873 |
ctaaaatatagttttagtacccgtaaatatgcctcgttttagtttta |
14007827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 15211513 - 15211559
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| |||||||| |||||| |
|
|
| T |
15211513 |
ctaaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
15211559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16060598 - 16060643
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
16060598 |
ctaaaatatggttttggtccct-caaatatgcctcgttttggtttta |
16060643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 17129691 - 17129737
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggtttta |
17129737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18928140 - 18928094
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||| ||||||||||| |
|
|
| T |
18928140 |
ctaaaatatggttttggtcgctgcaaatatgtctcattttagtttta |
18928094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21383106 - 21383152
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
21383106 |
ctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
21383152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26207280 - 26207326
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
26207326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 28507456 - 28507410
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
28507456 |
ctaaaatattgttttggtccctgcaaatatgtctcattttagtttta |
28507410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31060789 - 31060835
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
31060789 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
31060835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 32420100 - 32420146
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
32420100 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
32420146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 39025112 - 39025150
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgtttt |
39025150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 39025379 - 39025334
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||| |||||| |
|
|
| T |
39025379 |
ctaaaatatggttttggtccctgcaaa-atgcctcgttttggtttta |
39025334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 42482981 - 42483027
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
42482981 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
42483027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 2604191 - 2604154
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatg |
192 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
2604191 |
ttttaggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 4617091 - 4617136
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagtttta |
4617136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 15334919 - 15334972
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||| || ||| ||||||| |||||||| |||||||| |||| |
|
|
| T |
15334919 |
ctaaaatatggttttaatctctgtaaatatgactcgttttggttttaattcttg |
15334972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 26062255 - 26062210
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| |||| |||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggtttta |
26062210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 31404429 - 31404470
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagt |
204 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgttttagt |
31404470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 191
Target Start/End: Complemental strand, 41739118 - 41739089
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41739118 |
ctaaaatatggttttagtccctgcaaatat |
41739089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 42483269 - 42483224
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||| | ||||| ||||| |
|
|
| T |
42483269 |
ctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 1159739 - 1159707
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
1159739 |
gaaaatagtccctgaccccacttttatgatgat |
1159707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 2733285 - 2733317
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
2733285 |
gaaaatagtctctgaccccacttttgtgatgat |
2733317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 13260087 - 13260119
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
13260087 |
gaaaatagtccttgaccccacttttgtgatgat |
13260119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 13770590 - 13770622
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
13770590 |
gaaaatagtccctgaccccatttttgtgatgat |
13770622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 19622757 - 19622789
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
19622757 |
gaaaatagtccatgaccccacttttgtgatgat |
19622789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 22919783 - 22919815
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
22919783 |
gaaaatagtccctgaccccatttttgtgatgat |
22919815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 26191459 - 26191491
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
26191459 |
gaaaatagtccctgaccccatttttgtgatgat |
26191491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 32454189 - 32454157
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
32454189 |
gaaaatagtccctgaccccacttttatgatgat |
32454157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 32728948 - 32728916
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32728948 |
gaaaatagtccatgaccccacttttgtgatgat |
32728916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 33380255 - 33380203
Alignment:
| Q |
162 |
ctaaaatatggttttagtccc-tgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
33380255 |
ctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcct |
33380203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 48955964 - 48955932
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
48955964 |
gaaaatagtctctgaccccacttttgtgatgat |
48955932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 201
Target Start/End: Complemental strand, 49074060 - 49074012
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||| ||||||||||||||| |||| || |||||||| ||||||| |
|
|
| T |
49074060 |
tattttaggctaaaatatggttttggtccttgtaaatatgcttcgtttt |
49074012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 164)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 6118497 - 6118442
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
6118497 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggt |
6118442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 157 - 215
Target Start/End: Complemental strand, 18046351 - 18046293
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
18046351 |
ttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
18046293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 155 - 217
Target Start/End: Complemental strand, 29875730 - 29875668
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
29875730 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 5614535 - 5614482
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5614535 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5614482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 5950171 - 5950224
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5950171 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5950224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 10743726 - 10743779
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
10743726 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
10743779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 16038379 - 16038432
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
16038379 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
16038432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 25561997 - 25561948
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25561997 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatc |
25561948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 29692739 - 29692792
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29692739 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
29692792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 39379614 - 39379553
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
39379614 |
tttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggt |
39379553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 18633959 - 18633827
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
18633959 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgtttt |
18633861 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18633860 |
tgaaaatagtccctgaccccacttttgtgatgat |
18633827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 30800858 - 30800802
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30800858 |
atattctaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 34125302 - 34125362
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
34125302 |
ttttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttg |
34125362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 18633601 - 18633656
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
18633601 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 29172525 - 29172580
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
29172525 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 29172884 - 29172829
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
29172884 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2217496 - 2217542
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2217496 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 2217852 - 2217806
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2217852 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2217806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4203458 - 4203504
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4203458 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4203504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 7075574 - 7075620
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7075574 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
7075620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 10409331 - 10409285
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10409331 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
10409285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 153 - 215
Target Start/End: Complemental strand, 13990902 - 13990840
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
13990902 |
tatttaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
13990840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16616370 - 16616416
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagtttta |
16616416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 19565837 - 19565783
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
19565837 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19565783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28550829 - 28550875
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28550829 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28550875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28863512 - 28863558
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28863512 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 28863836 - 28863790
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28863836 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28863790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30800496 - 30800542
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30800496 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
30800542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35167163 - 35167117
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35167163 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
35167117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 36578081 - 36578035
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36578081 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
36578035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40029495 - 40029449
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40029495 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
40029449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 20660950 - 20661003
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
20660950 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttg |
20661003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 1105152 - 1105100
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1105152 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1105100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 9532532 - 9532480
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttg |
9532480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 14318040 - 14318100
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||| |||||||| |||||| |||||| |
|
|
| T |
14318040 |
ttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttg |
14318100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 31037745 - 31037693
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31037745 |
tttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 32108804 - 32108860
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
32108804 |
tttaggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatcc |
32108860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 293830 - 293869
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
293830 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
293869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 2636991 - 2636940
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
2636991 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcct |
2636940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 10408930 - 10408969
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10408930 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
10408969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 15635705 - 15635650
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||| ||| |||| |
|
|
| T |
15635705 |
ctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 213
Target Start/End: Complemental strand, 23382295 - 23382244
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
23382295 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct |
23382244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 25561707 - 25561762
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
25561707 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggt |
25561762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 212
Target Start/End: Original strand, 40029134 - 40029193
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||| || ||||||||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
40029134 |
tatttaaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatcc |
40029193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 40764408 - 40764463
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
40764408 |
tatttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
40764463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1381609 - 1381563
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1381609 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1381563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5917458 - 5917412
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5917458 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5917412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 6912499 - 6912545
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
6912499 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
6912545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9179918 - 9179872
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
9179918 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 11799456 - 11799410
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
11799456 |
ctaaaatatggttttagtccgtgcaaatatgcctcgttttggtttta |
11799410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 16038738 - 16038692
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
16038692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 19685378 - 19685332
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
19685378 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
19685332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24443742 - 24443696
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24443742 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24443696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26133185 - 26133231
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26133185 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
26133231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 26133411 - 26133365
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
26133411 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
26133365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29151849 - 29151803
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
29151849 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
29151803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29366947 - 29366901
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
29366947 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
29366901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 33336024 - 33335978
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
33336024 |
ctaaaatatggttttagtccctgcaaatatgactcgttttggtttta |
33335978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35166913 - 35166959
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
35166913 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
35166959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 35877058 - 35877004
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35877058 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35877004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35928066 - 35928112
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35928066 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35928112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 36577724 - 36577770
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
36577724 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36577770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 38170516 - 38170562
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
38170516 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
38170562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 38786161 - 38786207
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
38786161 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
38786207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40167788 - 40167834
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40167788 |
ctaaagtatggttttagtccctgcaaatatgcctcgttttggtttta |
40167834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 1104854 - 1104899
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1104854 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgtttt |
1104899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 3850301 - 3850346
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
3850301 |
ctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 5614168 - 5614221
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
5614168 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttg |
5614221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 18258525 - 18258472
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
18258525 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
18258472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 20985728 - 20985773
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20985773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 27916761 - 27916716
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggtttta |
27916716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 29693088 - 29693035
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
29693088 |
ctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttg |
29693035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 147 - 212
Target Start/End: Complemental strand, 40038871 - 40038806
Alignment:
| Q |
147 |
atcaaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||| ||||||| | |||||||||| |||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
40038871 |
atcatatatttttggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatcc |
40038806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 42596814 - 42596769
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagtttta |
42596769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 153 - 210
Target Start/End: Original strand, 42994061 - 42994118
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
42994061 |
tatttttggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaat |
42994118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 4203773 - 4203729
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4203773 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
4203729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 18286431 - 18286483
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||| ||||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggttttaatccttg |
18286483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 30888162 - 30888294
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| ||| | || |||||||||||||||||||||| |
|
|
| T |
30888162 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct-gtagaattttttttttgtttttggtccctgcaaaattttttgtttt |
30888260 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30888261 |
tgaaaatagtccctgaccccacttttgtgatgat |
30888294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 3850594 - 3850551
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
3850594 |
aaatatggttttagtccctgcaaatatgtctcgttttggtttta |
3850551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 18046040 - 18046079
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18046040 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
18046079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 20986087 - 20986048
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20986087 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttt |
20986048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 21050911 - 21050872
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21050911 |
ctaaaatatggttttagtccctgcaaatatgcatcgtttt |
21050872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 25779165 - 25779114
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| || |||| |||||| |
|
|
| T |
25779165 |
ttaggctaaaatatggttttagtccctgcaaatatgcttcattttggtttta |
25779114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 29151518 - 29151557
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29151518 |
ctaaaatatgattttagtccctgcaaatatgcctcgtttt |
29151557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 29875402 - 29875457
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
29875402 |
ctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggt |
29875457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 154 - 217
Target Start/End: Complemental strand, 35166164 - 35166101
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| ||| |||||||| |||||| ||| |||| |
|
|
| T |
35166164 |
attttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggt |
35166101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 37271356 - 37271407
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
37271356 |
ttaggctaaaatatggttttggtctctgcaaatatgcctcgttttggtttta |
37271407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 38496780 - 38496725
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||| ||| |||| |
|
|
| T |
38496780 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 45140 - 45186
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
45140 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1381249 - 1381295
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
1381249 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1381295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 2032938 - 2032892
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
2032938 |
ctaaattatggttttagtccctgcaaatatgtctcgttttggtttta |
2032892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5917128 - 5917174
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
5917128 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
5917174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6912855 - 6912809
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
6912809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10744052 - 10744006
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
10744052 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
10744006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11799131 - 11799177
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
11799131 |
ctaaaatatggttttagtccctgcaaatatgcattgttttggtttta |
11799177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 17070861 - 17070815
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
17070861 |
ctaaaatatggttttagtccctacaaatatgtctcgttttcgtttta |
17070815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18286739 - 18286693
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
18286739 |
ctaaaaaatggttttagtccctgcaaatatacctcgttttggtttta |
18286693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19565469 - 19565515
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
19565469 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19565515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19685019 - 19685065
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
19685019 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19685065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 20690735 - 20690781
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20690735 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20690781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21124915 - 21124961
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
21124915 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
21124961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 23381952 - 23381998
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
23381952 |
ctaaaatatggttttagtccctgcaaatatgtctggttttggtttta |
23381998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24443382 - 24443428
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
24443382 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
24443428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24781991 - 24782037
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
24781991 |
ctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24782037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28213375 - 28213421
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
28213375 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28213421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 28871992 - 28871946
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
28871992 |
ctaaattatggttttggtccctgcaaatatgcctcgttttggtttta |
28871946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 34125630 - 34125584
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
34125630 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
34125584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35609635 - 35609589
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35609589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35876690 - 35876736
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
35876690 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
35876736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35928456 - 35928410
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35928456 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35928410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 38962808 - 38962854
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
38962808 |
ctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
38962854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 40038496 - 40038546
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
40038496 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatcc |
40038546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40764778 - 40764732
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40764778 |
ctaaaatatggttttgctccctgcaaatatgcctcgttttggtttta |
40764732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 28108159 - 28108114
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggtttta |
28108114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 38452394 - 38452345
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatc |
38452345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 211
Target Start/End: Complemental strand, 45501 - 45453
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttaatc |
45453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 294091 - 294059
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
294091 |
gaaaatagtccctgaccccacttttgtgatgat |
294059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 2217756 - 2217724
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2217756 |
gaaaatagtccctgaccccacttttgtgatgat |
2217724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 4203554 - 4203586
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4203554 |
gaaaatagtccctgaccccacttttgtgatgat |
4203586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 6118393 - 6118361
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6118393 |
gaaaatagtccctgaccccacttttgtgatgat |
6118361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 15635477 - 15635509
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15635477 |
gaaaatagtccctgaccccacttttgtgatgat |
15635509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 23382208 - 23382176
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23382208 |
gaaaatagtccctgaccccacttttgtgatgat |
23382176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 25779060 - 25779028
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25779060 |
gaaaatagtccctgaccccacttttgtgatgat |
25779028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 29151618 - 29151650
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29151618 |
gaaaatagtccctgaccccacttttgtgatgat |
29151650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 32888691 - 32888735
Alignment:
| Q |
164 |
aaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgtttta |
32888735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 35166058 - 35166026
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35166058 |
gaaaatagtccctgaccccacttttgtgatgat |
35166026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 38962992 - 38962960
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38962992 |
gaaaatagtccctgaccccacttttgtgatgat |
38962960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 42207342 - 42207374
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42207342 |
gaaaatagtccctgaccccacttttgtgatgat |
42207374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 12145181 - 12145142
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgtttt |
12145142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 20683749 - 20683788
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
20683749 |
ctaaaatatggttttagtctctgcaaatatgcatcgtttt |
20683788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 31037397 - 31037436
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgtttt |
31037436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 37271704 - 37271665
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
37271704 |
ctaaaatatggttttggtccctgcaaatatgtctcgtttt |
37271665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1286684 - 1286730
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||| |||||| |
|
|
| T |
1286684 |
ctaaaatatggtgttggtccctacaaatatgcctcgttttggtttta |
1286730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2636671 - 2636717
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||| |||||| |
|
|
| T |
2636671 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
2636717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4736540 - 4736494
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
4736540 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
4736494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 201
Target Start/End: Original strand, 6118139 - 6118173
Alignment:
| Q |
167 |
atatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgtttt |
6118173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9179595 - 9179641
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
9179595 |
ctaaaatatggttttagtccttgcaaatatgattcgttttggtttta |
9179641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12144909 - 12144955
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||| |||||| |
|
|
| T |
12144909 |
ctaaaatatggtttttgtccctgtaaatatgcctctttttggtttta |
12144955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 15635379 - 15635433
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||| |||||| ||| |||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggt |
15635433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 17070537 - 17070575
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
17070537 |
ctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18258164 - 18258210
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
18258164 |
ctaaaatatggttttggtccctgcaaatatggctcattttggtttta |
18258210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 20661309 - 20661263
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||| |||||| |
|
|
| T |
20661309 |
ctaaaatatggttttggtccgtgcaaatatgcttcgttttggtttta |
20661263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 22551214 - 22551184
Alignment:
| Q |
264 |
aaaatagtccctgaccccacttttgtgatga |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22551214 |
aaaatagtccctgaccccacttttgtgatga |
22551184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 293
Target Start/End: Complemental strand, 27850275 - 27850245
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
27850275 |
gaaaatagtccctgaccccacttttgtgatg |
27850245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 27850372 - 27850326
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggtttta |
27850326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35609305 - 35609351
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||| |||||| |
|
|
| T |
35609305 |
ctaaaatatggttttggtccatgcaaatatgcatcgttttggtttta |
35609351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 42207244 - 42207290
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||| |||||| |
|
|
| T |
42207244 |
ctaaaatatggttttagtccttgtaaatatgtctcgttttggtttta |
42207290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 42207570 - 42207525
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggtttta |
42207525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 42553644 - 42553690
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
42553644 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42553690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 22550960 - 22551005
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||| | || ||||||| |||||||||||||| |
|
|
| T |
22550960 |
ctaaaatatggttttagtacatgtaaatatgtctcgttttagtttt |
22551005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 29172625 - 29172654
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29172625 |
gaaaatagtccctgaccccacttttgtgat |
29172654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 36278076 - 36278129
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
36278076 |
ttttaggctaaaatatggttttgatccctgcaaatatgtttcattttagtttta |
36278129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 5614428 - 5614396
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
5614428 |
gaaaatagtccctgacaccacttttgtgatgat |
5614396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 5904005 - 5904049
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5904005 |
ttaggctaaaatatggttttgctccttgcaaatatgcctcgtttt |
5904049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 16616463 - 16616495
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
16616463 |
gaaaatagtccatgaccccacttttgtgatgat |
16616495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 206
Target Start/End: Original strand, 20416362 - 20416406
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| ||| |||| |
|
|
| T |
20416362 |
ctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 28550927 - 28550959
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28550927 |
gaaaatagtccctaaccccacttttgtgatgat |
28550959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 29692991 - 29692959
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
29692991 |
gaaaatagtccctgaccccacttttatgatgat |
29692959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 31037497 - 31037529
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
31037497 |
gaaaatagtctctgaccccacttttgtgatgat |
31037529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 35167064 - 35167032
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
35167064 |
gaaaatagtctctgaccccacttttgtgatgat |
35167032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 36577821 - 36577853
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
36577821 |
gaaaatagtccctgatcccacttttgtgatgat |
36577853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 37090640 - 37090608
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
37090640 |
gaaaatagtctctgaccccacttttgtgatgat |
37090608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 38496521 - 38496553
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
38496521 |
gaaaatagtctctgaccccacttttgtgatgat |
38496553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 181)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 43788860 - 43788915
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
43788860 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggt |
43788915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 33733239 - 33733189
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33733239 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatcc |
33733189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 44985615 - 44985669
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44985615 |
attttagactaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
44985669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 22881615 - 22881668
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
22881615 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
22881668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 38980251 - 38980120
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
38980251 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaattttttgtttt |
38980154 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38980153 |
tgaaaatagtccctgaccccacttttgtgatgat |
38980120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 40301977 - 40302109
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||| | || |||||||||||||||||||||| |
|
|
| T |
40301977 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaatattttgtttt |
40302075 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40302076 |
tgaaaatagtccctgaccccacttttgtgatgat |
40302109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 16900204 - 16900149
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
16900204 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 16993595 - 16993540
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
16993595 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 19184149 - 19184094
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
19184149 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 26814227 - 26814172
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
26814227 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26814172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 33732855 - 33732910
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33732855 |
tatttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33732910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 37271741 - 37271796
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
37271741 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 37272100 - 37272045
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
37272100 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37272045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 10374776 - 10374822
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10374776 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
10374822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 10375067 - 10375017
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
10375067 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatcc |
10375017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 24358610 - 24358664
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24358610 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24358664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24483889 - 24483843
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24483889 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
24483843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 43597148 - 43597202
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
43597148 |
attttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
43597202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 10671939 - 10671886
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
10671939 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
10671886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 23989833 - 23989886
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23989833 |
ttttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
23989886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 42358702 - 42358747
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
42358747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 14392791 - 14392843
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
14392791 |
taaaatatggttttagtcattgtaaatatgcctcgttttagttttaatccttg |
14392843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 17541783 - 17541719
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| || |||||||||||||||| |||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
17541783 |
tatttaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggt |
17541719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 25705453 - 25705401
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
25705453 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25705401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 206
Target Start/End: Original strand, 27310878 - 27310922
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27310878 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 146323 - 146374
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
146323 |
ttagactaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
146374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 2481564 - 2481509
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| || ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
2481564 |
tatttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
2481509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 3671187 - 3671144
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggtttta |
3671144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 5790560 - 5790615
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
5790560 |
ctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 16673774 - 16673723
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
16673774 |
ttaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgtttta |
16673723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 17541384 - 17541439
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||| ||| |||| |
|
|
| T |
17541384 |
ctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 19183784 - 19183916
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |||||||||| ||||||||||| |
|
|
| T |
19183784 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaat-tttgtttttgatccctgcaaaattttttgtttt |
19183882 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19183883 |
tgaaaatagtccctgaccccacttttgtgatgat |
19183916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 26813868 - 26813923
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
26813868 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 27311076 - 27311021
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||| |||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
27311076 |
tattgtaggctaaaatatggttttagtccatgcaaatatgcctcgttttggtttta |
27311021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 38639409 - 38639460
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
38639409 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
38639460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 41694010 - 41693955
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| | |||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41694010 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
41693955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 43592043 - 43592094
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
43592043 |
ttaggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
43592094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 43789190 - 43789058
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
43789190 |
ctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggt-aaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
43789092 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43789091 |
tgaaaatagtccctgaccccacttttgtgatgat |
43789058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 44073805 - 44073766
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44073805 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
44073766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3838262 - 3838216
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
3838262 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
3838216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4423897 - 4423943
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
4423897 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
4423943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5334753 - 5334799
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5334753 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5335038 - 5334992
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5335038 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
5334992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5790897 - 5790851
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
5790897 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
5790851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8046331 - 8046377
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8046331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
8046377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 8046646 - 8046600
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
8046646 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
8046600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9195056 - 9195102
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
9195056 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
9195102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9195204 - 9195158
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
9195204 |
ctaaaatatggttttagaccctgcaaatatgcctcgttttggtttta |
9195158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11713487 - 11713533
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
11713487 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11713533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 11713843 - 11713797
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11713843 |
ctaaaatacggttttagtccctgcaaatatgcctcgttttggtttta |
11713797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 11788414 - 11788368
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
11788414 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
11788368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14003740 - 14003694
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
14003740 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
14003694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 15842821 - 15842775
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
15842821 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16522993 - 16523039
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
16522993 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 16523323 - 16523277
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
16523323 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16523277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 20131679 - 20131633
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
20131679 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
20131633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29859870 - 29859824
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29859870 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 29865223 - 29865269
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29865223 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
29865269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 31226075 - 31226029
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31226075 |
ctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31325922 - 31325968
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
31325922 |
ctaaaatatggttctagtccctgcaaatatgcatcgttttagtttta |
31325968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 31326250 - 31326204
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31326250 |
ctaaaatatagttttagtccttgcaaatatgcctcgttttagtttta |
31326204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 32691315 - 32691365
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
32691315 |
ctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatcc |
32691365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 34964157 - 34964111
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
34964157 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttagtttta |
34964111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 36622252 - 36622298
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
36622252 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
36622298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 36622582 - 36622536
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
36622536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 37911118 - 37911068
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
37911118 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatcc |
37911068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 38731831 - 38731877
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38731831 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
38731877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40302337 - 40302291
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
40302337 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
40302291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44994059 - 44994013
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
44994059 |
ctaaaatatggttttaatccctgcaaatatgtctcgttttagtttta |
44994013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 7814742 - 7814689
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| |||| |||||| |
|
|
| T |
7814742 |
ttttaggctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
7814689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 14003404 - 14003457
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
14003404 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
14003457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 15842464 - 15842509
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
15842509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 17912808 - 17912763
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
17912763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 20131312 - 20131365
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20131312 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20131365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 29859490 - 29859535
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29859535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 35155298 - 35155347
Alignment:
| Q |
166 |
aatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
35155347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 1138363 - 1138311
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
1138363 |
tttaggctaaaatatggttttgatccctgcaaatatgtctcgttttagtttta |
1138311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 3671000 - 3671044
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3671000 |
ttaggctaaaatatggttttagtccatgcaaatatgcctcgtttt |
3671044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 10664981 - 10665025
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10664981 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgtttt |
10665025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 17912441 - 17912497
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
17912441 |
atattttaggttaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
17912497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 41791310 - 41791266
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
41791310 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 44985988 - 44985936
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
44985988 |
tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
44985936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 1497612 - 1497651
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1497612 |
ctaaaatatggttttagtccttgcaaatatgcctcgtttt |
1497651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 4042612 - 4042663
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
4042612 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcct |
4042663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 7814248 - 7814303
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |||||| ||| |||| |
|
|
| T |
7814248 |
ctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 26239158 - 26239119
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26239158 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
26239119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 31225717 - 31225756
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31225717 |
ctaaaatatagttttagtccctgcaaatatgcctcgtttt |
31225756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1497943 - 1497897
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggtttta |
1497897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3837935 - 3837981
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
3837935 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttcgtttta |
3837981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4424183 - 4424137
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
4424183 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
4424137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12835327 - 12835373
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |||||| |
|
|
| T |
12835327 |
ctaaaatatgattttagtccctgcaaatatgcctcattttggtttta |
12835373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13215062 - 13215108
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
13215062 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13215108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18113091 - 18113137
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
18113091 |
ctaaaatatggttttggtccctgcaaatatgcctagttttggtttta |
18113137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 18113452 - 18113402
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
18113452 |
ctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatcc |
18113402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 20658063 - 20658109
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
20658063 |
ctaaaacatggttttagtccctgcaaatatgccttgttttggtttta |
20658109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 20939323 - 20939277
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
20939323 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
20939277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24358943 - 24358897
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24358943 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
24358897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24483402 - 24483448
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |||||| |
|
|
| T |
24483402 |
ctaaaatatggctttagtccttgcaaatatgcctcgttttggtttta |
24483448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25705087 - 25705133
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
25705087 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25705133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 25954423 - 25954385
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgtttt |
25954385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 26238816 - 26238854
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
26238854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 27109075 - 27109121
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
27109075 |
ctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
27109121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29865509 - 29865463
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
29865509 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggtttta |
29865463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30215424 - 30215470
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
30215424 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
30215470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31644843 - 31644889
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
31644843 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
31644889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 204
Target Start/End: Complemental strand, 32691633 - 32691591
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagt |
204 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32691633 |
ctaaaacatggttttagtccctgcaaatatgtctcgttttagt |
32691591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 33576115 - 33576069
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
33576115 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
33576069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 34317800 - 34317846
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
34317800 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
34317846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 40124968 - 40125014
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
40124968 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
40125014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 41451839 - 41451885
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
41451839 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
41451885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 41693676 - 41693722
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
41693676 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
41693722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 41791020 - 41791066
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggtttta |
41791066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 42695870 - 42695916
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
42695870 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42695916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 42696201 - 42696155
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
42696201 |
ctaaaatatggttttgatccctgcaaatatgcctcgttttggtttta |
42696155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44559064 - 44559110
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
44559064 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44559407 - 44559361
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
44559361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 4042888 - 4042835
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
4042888 |
ctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtccttg |
4042835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 16900135 - 16900098
Alignment:
| Q |
173 |
ttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggttttaat |
16900098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 16968555 - 16968600
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggtttta |
16968600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 173 - 210
Target Start/End: Complemental strand, 16993526 - 16993489
Alignment:
| Q |
173 |
ttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggttttaat |
16993489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 23990193 - 23990148
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
23990148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 25954117 - 25954170
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
25954117 |
ctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttg |
25954170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 33575747 - 33575800
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
33575747 |
ttttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
33575800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 34318081 - 34318028
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
34318081 |
ctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttg |
34318028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 40786455 - 40786508
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||| |||||||| |||||| |
|
|
| T |
40786455 |
ttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggtttta |
40786508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 14393029 - 14392997
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14393029 |
gaaaatagtccctgaccccacttttgtgatgat |
14392997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 20658412 - 20658368
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
20658412 |
ttaggctaaaatatggttttaatccctgcaaatatgtctcgtttt |
20658368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 23732326 - 23732282
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
23732326 |
ctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 23989937 - 23989969
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23989937 |
gaaaatagtccctgaccccacttttgtgatgat |
23989969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 26814127 - 26814095
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26814127 |
gaaaatagtccctgaccccacttttgtgatgat |
26814095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 164 - 208
Target Start/End: Complemental strand, 36806892 - 36806848
Alignment:
| Q |
164 |
aaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
36806848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 41693901 - 41693869
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41693901 |
gaaaatagtccctgaccccacttttgtgatgat |
41693869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 41791119 - 41791151
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41791119 |
gaaaatagtccctgaccccacttttgtgatgat |
41791151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 44985722 - 44985754
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
44985722 |
gaaaatagtccctgaccccacttttgtgatgat |
44985754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 45442318 - 45442366
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||| |
|
|
| T |
45442318 |
ctaaaatatggttttagtctctgcaaatatgtctcgttttgattttaat |
45442366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 37910753 - 37910804
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||||||| ||||||||||| |
|
|
| T |
37910753 |
ttaggctaaaatatggttttgatccttgcaaatatgcctcattttagtttta |
37910804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 264 - 295
Target Start/End: Original strand, 38731929 - 38731960
Alignment:
| Q |
264 |
aaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38731929 |
aaaatagtccctgaccccacttttgtgatgat |
38731960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 43671927 - 43671982
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| || ||||||||||||||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
43671927 |
tatttaaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggtttta |
43671982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 146688 - 146642
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
146688 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
146642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3172022 - 3172068
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
3172022 |
ctaaaatatgattttggtccctgcaaatatgcctcattttggtttta |
3172068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3172530 - 3172484
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
3172530 |
ctaaaatatgattttggtccttgcaaatatgcctcgttttggtttta |
3172484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 4794132 - 4794178
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
4794132 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
4794178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10665292 - 10665246
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
10665292 |
ctaaaatatagttttagtctctgcaaatatgcatcgttttggtttta |
10665246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 10671632 - 10671678
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
10671632 |
ctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
10671678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 13215368 - 13215318
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
13215368 |
ttaggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16673413 - 16673459
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
16673413 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
16673459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 17302141 - 17302095
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||| |
|
|
| T |
17302141 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
17302095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25299747 - 25299793
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaatttta |
25299793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26707875 - 26707921
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||||| |||||| |
|
|
| T |
26707875 |
ctaaaatatggttttaatccctgcaaatatacttcgttttggtttta |
26707921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 196
Target Start/End: Complemental strand, 31909476 - 31909442
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctc |
196 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31909476 |
ctaaaatatggttttggtccctgcaaatatgcctc |
31909442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 32476097 - 32476143
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
32476097 |
ctaaaatatggttttgatccctgcaaatatgcctcattttggtttta |
32476143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 36815833 - 36815787
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
36815833 |
ctaaaatatggttttggtccatgcaaatatgtctcgttttggtttta |
36815787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 37228735 - 37228781
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
37228735 |
ctaaaatatggttttggtccctgcaaatatgtatcgttttggtttta |
37228781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 40125287 - 40125241
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
40125287 |
ctaaaatatgattttggtccctgcaaatatgcctcatttttgtttta |
40125241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 43597497 - 43597451
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
43597497 |
ctaaaatatgattttagtccctgctaatatgtctcgttttggtttta |
43597451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 43710706 - 43710660
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||||||||| |||||| |
|
|
| T |
43710706 |
ctaaaatatgattttagcccttgcaaatatgcctcgttttggtttta |
43710660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 3832634 - 3832589
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
3832589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 13850881 - 13850836
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| || ||||||||||||| ||||||| |||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggtttta |
13850836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 263 - 292
Target Start/End: Original strand, 17912550 - 17912579
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17912550 |
gaaaatagtccctgaccccacttttgtgat |
17912579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 191
Target Start/End: Original strand, 38979891 - 38979920
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38979891 |
ctaaaatatggttttagtccctgcaaatat |
38979920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 3838162 - 3838130
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
3838162 |
gaaaatagtccctgacaccacttttgtgatgat |
3838130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 5790797 - 5790765
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
5790797 |
gaaaatagtccttgaccccacttttgtgatgat |
5790765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 7814505 - 7814473
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
7814505 |
gaaaatagtctctgaccccacttttgtgatgat |
7814473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 7814638 - 7814606
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
7814638 |
gaaaatagtctctgaccccacttttgtgatgat |
7814606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 8046430 - 8046462
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
8046430 |
gaaaatagtctctgaccccacttttgtgatgat |
8046462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 10665084 - 10665116
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
10665084 |
gaaaatagtctctgaccccacttttgtgatgat |
10665116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 12835427 - 12835459
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
12835427 |
gaaaatagtccctgaccctacttttgtgatgat |
12835459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 13802488 - 13802536
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||||||||||||||||| | || |||||| ||||||||| |||||||| |
|
|
| T |
13802488 |
ctaaaatatggttttagttcttgtaaatattcctcgttttggttttaat |
13802536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 16899996 - 16900028
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
16899996 |
gaaaataatccctgaccccacttttgtgatgat |
16900028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 16993387 - 16993419
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
16993387 |
gaaaataatccctgaccccacttttgtgatgat |
16993419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 22881869 - 22881837
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22881869 |
gaaaatagtccctaaccccacttttgtgatgat |
22881837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 24483632 - 24483664
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
24483632 |
gaaaatagtccctgatcccacttttgtgatgat |
24483664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 26238912 - 26238944
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
26238912 |
gaaaatagtccctggccccacttttgtgatgat |
26238944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 214
Target Start/End: Original strand, 29831816 - 29831868
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcctt |
214 |
Q |
| |
|
||||||||| ||||| |||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
29831816 |
ctaaaatatagttttgatccctgcaaatatgtctcgttttggtttcaatcctt |
29831868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 31225817 - 31225849
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
31225817 |
gaaaatagtccttgaccccacttttgtgatgat |
31225849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 37272001 - 37271969
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
37272001 |
gaaaatagtccatgaccccacttttgtgatgat |
37271969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 40786561 - 40786593
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
40786561 |
gaaaatagtccatgaccccacttttgtgatgat |
40786593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 43592146 - 43592178
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
43592146 |
gaaaatagtccctgaccccatttttgtgatgat |
43592178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 43597400 - 43597368
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
43597400 |
gaaaatagtccctgaccccatttttgtgatgat |
43597368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 43710480 - 43710512
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
43710480 |
gaaaatagtccctgacctcacttttgtgatgat |
43710512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 8e-18; HSPs: 179)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 8555797 - 8555747
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8555797 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatcc |
8555747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28911579 - 28911625
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28911579 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
28911625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 45073309 - 45073366
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
45073309 |
ttttaggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatcc |
45073366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 46648713 - 46648660
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
46648713 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttg |
46648660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 7431953 - 7432085
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
7431953 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaa-ttgtttttggtccctgcaaaattttttgtttt |
7432051 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7432052 |
tgaaaatagtccctgaccccacttttgtgatgat |
7432085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 39719650 - 39719594
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39719650 |
atatattaggctaaaatatggttttagtccctgcaaatatggctcgttttagtttta |
39719594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 1006837 - 1006892
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
1006837 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 6108336 - 6108391
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
6108336 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 44508722 - 44508777
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
44508722 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 44509052 - 44508997
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
44509052 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1559703 - 1559657
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1559703 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttaatttta |
1559657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 6509210 - 6509256
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6509210 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttcgtttta |
6509256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 12894400 - 12894354
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12894400 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
12894354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 17999719 - 17999673
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17999719 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
17999673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19561156 - 19561202
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19561156 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19561202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 19757750 - 19757796
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19757750 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19757796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 27037595 - 27037641
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27037595 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
27037641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 28911904 - 28911858
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28911904 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
28911858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 31732103 - 31732153
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31732103 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatcc |
31732153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 37372902 - 37372856
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37372902 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
37372856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 156 - 213
Target Start/End: Complemental strand, 3975842 - 3975785
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
3975842 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcct |
3975785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 13769776 - 13769829
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
13769776 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
13769829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 17999467 - 17999512
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17999467 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 18022702 - 18022649
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
18022702 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttg |
18022649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 23399607 - 23399660
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23399607 |
ttttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23399660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 39832901 - 39832954
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
39832901 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
39832954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 48852446 - 48852499
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
48852446 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttg |
48852499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 1007227 - 1007096
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
1007227 |
ctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaattttttgtttt |
1007130 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1007129 |
tgaaaatagtccctgaccccacttttgtgatgat |
1007096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 20388270 - 20388322
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
20388270 |
tttaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
20388322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 46759653 - 46759713
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
46759653 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
46759713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 6079811 - 6079850
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6079811 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
6079850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 16853596 - 16853541
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
16853596 |
tatttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
16853541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 23816667 - 23816718
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23816667 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
23816718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 25988378 - 25988433
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
25988378 |
tattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25988433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 206
Target Start/End: Original strand, 30352563 - 30352606
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttt |
30352606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 32189393 - 32189342
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
32189393 |
ttagactaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
32189342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 35015218 - 35015179
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35015218 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
35015179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 153 - 208
Target Start/End: Complemental strand, 35104302 - 35104247
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35104302 |
tattttaggctcaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35104247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 45021496 - 45021535
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45021496 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
45021535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 1559345 - 1559395
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1559345 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatcc |
1559395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 1614902 - 1614856
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1614902 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
1614856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 3975551 - 3975597
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
3975551 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
3975597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5308325 - 5308371
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5308325 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttagtttta |
5308371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6509468 - 6509422
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
6509468 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
6509422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 216
Target Start/End: Original strand, 6589023 - 6589077
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttgg |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
6589023 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccttgg |
6589077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 8144656 - 8144610
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8144656 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
8144610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9659687 - 9659641
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
9659687 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
9659641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10358366 - 10358320
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
10358366 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
10358320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13770079 - 13770033
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
13770079 |
ctaaaatatggttttagtccctgcaaatatgccccgttttggtttta |
13770033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 19561448 - 19561402
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
19561448 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
19561402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 21223746 - 21223700
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
21223746 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
21223700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 23676450 - 23676404
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23676450 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23676404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 25988747 - 25988701
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
25988747 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
25988701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 26878069 - 26878023
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
26878069 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
26878023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 28262715 - 28262765
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
28262715 |
ctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatcc |
28262765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29198660 - 29198614
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29198660 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29198614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35210513 - 35210467
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
35210513 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
35210467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 39833234 - 39833188
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
39833234 |
ctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
39833188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44344787 - 44344741
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
44344787 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
44344741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45021854 - 45021808
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
45021854 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
45021808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45073639 - 45073593
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45073639 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45073593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45228916 - 45228870
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
45228916 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
45228870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 48192486 - 48192440
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
48192486 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 48359073 - 48359027
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
48359073 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
48359027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 5354763 - 5354816
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
5354763 |
ttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
5354816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 18891562 - 18891517
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaatttta |
18891517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 19783817 - 19783870
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
19783817 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttg |
19783870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 21554395 - 21554448
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
21554395 |
ctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttg |
21554448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 25547256 - 25547301
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggtttta |
25547301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 30223793 - 30223740
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
30223793 |
ctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttg |
30223740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 32189078 - 32189127
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32189078 |
ctaaaatatgattttagtccctgcaaatatgcttcgttttggttttaatc |
32189127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 35837926 - 35837979
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
35837926 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttg |
35837979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 35838342 - 35838289
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35838342 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35838289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 41054241 - 41054188
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
41054241 |
ttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
41054188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 45671217 - 45671262
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagtttta |
45671262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 48192260 - 48192305
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
48192305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 207
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 17854145 - 17854197
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
17854145 |
tttagactaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
17854197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 23676124 - 23676180
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
23676124 |
atattttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23676180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 30709328 - 30709380
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttg |
30709380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 31310677 - 31310633
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
31310677 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 37372441 - 37372485
Alignment:
| Q |
164 |
aaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
37372485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 162 - 214
Target Start/End: Original strand, 46304088 - 46304140
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcctt |
214 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
46304088 |
ctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcctt |
46304140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 1614552 - 1614607
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
1614552 |
tattataggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
1614607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 14739002 - 14738963
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14739002 |
ctaaaatatggttttagtccctgcaaatatgcttcgtttt |
14738963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 21554751 - 21554712
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21554751 |
ctaaaatatggttttagtccctgcaaatatgccttgtttt |
21554712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 25547488 - 25547449
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
25547488 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
25547449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 30352902 - 30352863
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30352902 |
ctaaaatatagttttagtccctgcaaatatgcctcgtttt |
30352863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 30709647 - 30709596
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| |||||||| |||||| |
|
|
| T |
30709647 |
ttaggctaaaatatgattttagtccctgcaaatatgtctcgttttggtttta |
30709596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 31732449 - 31732410
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31732449 |
ctaaaatatggttttagtccatgcaaatatgcctcgtttt |
31732410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 35665874 - 35665925
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35665874 |
ttaggctaaaatatggttttaatccctacaaatatgcctcgttttggtttta |
35665925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 39438738 - 39438789
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
39438738 |
ttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggtttta |
39438789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 43300614 - 43300665
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||| |||||| |||| |
|
|
| T |
43300614 |
ctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcct |
43300665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 1974011 - 1974057
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1974011 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
1974057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5233810 - 5233856
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
5233810 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
5233856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6847117 - 6847071
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
6847071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8144297 - 8144343
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
8144297 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
8144343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 10358003 - 10358049
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||| |||||| |
|
|
| T |
10358003 |
ctaaaatatgatcttagtccctgcaaatatgcctcgttttggtttta |
10358049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18022369 - 18022415
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||| |
|
|
| T |
18022369 |
ctaaaatatggttttagtccccgcaaatatgtctcgttttggtttta |
18022415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18311582 - 18311628
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
18311582 |
ctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18927089 - 18927043
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18927089 |
ctaaaatatagttttagtccctgcaaatatgtctcattttagtttta |
18927043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 21223407 - 21223453
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
21223407 |
ctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
21223453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 23399974 - 23399928
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
23399974 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
23399928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25092162 - 25092208
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
25092162 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25092208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 25092546 - 25092500
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
25092546 |
ctaaaatatggttttggtccctgcaaatatgcctctttttggtttta |
25092500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 27458401 - 27458447
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
27458401 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27458447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 31503780 - 31503742
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgtttt |
31503742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 38186369 - 38186407
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
38186407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 38486472 - 38486526
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||||||||| |||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
38486472 |
attttaggctaaaatatgattttggtccctgtaaatatgtctcgttttagtttta |
38486526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 39719355 - 39719401
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
39719355 |
ctaaaatatggttttagtccctacaaatatgcctcattttggtttta |
39719401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 41365212 - 41365166
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |||||| |
|
|
| T |
41365212 |
ctaaaatatggttttagttcccgcaaatatgcctcgttttggtttta |
41365166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44402962 - 44403008
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||| |||||| |
|
|
| T |
44402962 |
ctaaaatatggttttagtccctgcaaatatgccccattttggtttta |
44403008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44403247 - 44403201
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
44403247 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
44403201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 5355114 - 5355069
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggtttta |
5355069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 6589271 - 6589226
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggtttta |
6589226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 11767280 - 11767227
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| || |||| |||||| |
|
|
| T |
11767280 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcattttggtttta |
11767227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 175 - 212
Target Start/End: Original strand, 12894056 - 12894093
Alignment:
| Q |
175 |
ttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatcc |
12894093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 16941049 - 16941004
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
16941004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 34878123 - 34878074
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
34878123 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatc |
34878074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 44344459 - 44344512
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||| ||||||||||||| |
|
|
| T |
44344459 |
ctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaatccttg |
44344512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 44841711 - 44841670
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagt |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactcgttttagt |
44841670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 45671545 - 45671500
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagtttta |
45671500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 1559605 - 1559573
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1559605 |
gaaaatagtccctgaccccacttttgtgatgat |
1559573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 6108596 - 6108564
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6108596 |
gaaaatagtccctgaccccacttttgtgatgat |
6108564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 28911679 - 28911711
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28911679 |
gaaaatagtccctgaccccacttttgtgatgat |
28911711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 30709425 - 30709457
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30709425 |
gaaaatagtccctgaccccacttttgtgatgat |
30709457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 37372804 - 37372772
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37372804 |
gaaaatagtccctgaccccacttttgtgatgat |
37372772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 39719455 - 39719487
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39719455 |
gaaaatagtccctgaccccacttttgtgatgat |
39719487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 45021597 - 45021629
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45021597 |
gaaaatagtccctgaccccacttttgtgatgat |
45021629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 169 - 208
Target Start/End: Complemental strand, 1271590 - 1271551
Alignment:
| Q |
169 |
atggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggtttta |
1271551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 12932781 - 12932742
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
12932781 |
ctaaaatatgtttttggtccctgcaaatatgcctcgtttt |
12932742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 20388673 - 20388634
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
20388673 |
ctaaaatatggttttagtcgctgaaaatatgcctcgtttt |
20388634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 31310362 - 31310413
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31310362 |
ttaggctaaaatatgattttagtccctgcaaatatttctcgttttggtttta |
31310413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 41053844 - 41053883
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
41053844 |
ctaaaatatggttttggtccctgcaaatatgcctcatttt |
41053883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 173 - 207
Target Start/End: Complemental strand, 1271526 - 1271492
Alignment:
| Q |
173 |
ttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
1271526 |
ttttagtccctgcaaatatgtctcgttttagtttt |
1271492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 2945843 - 2945797
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
2945843 |
ctaaaatatgtttttggtccctacaaatatgcctcgttttggtttta |
2945797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5234202 - 5234156
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||| |||||| |
|
|
| T |
5234202 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5234156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5308684 - 5308639
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
5308684 |
ctaaaatatg-ttttagtccctgcaaatatacctcgttttggtttta |
5308639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6911245 - 6911199
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||||| |||||| |
|
|
| T |
6911245 |
ctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 7432249 - 7432211
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgtttt |
7432211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 153 - 215
Target Start/End: Original strand, 8555600 - 8555662
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||| ||||||||| |||||||| ||||||||||| || ||||| |||||||| |||| |
|
|
| T |
8555600 |
tattttaggctaaaatatagttttagtttctgcaaatatgacttgttttggttttaattcttg |
8555662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14543712 - 14543758
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
14543712 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14543758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 213
Target Start/End: Original strand, 14738603 - 14738653
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |||||| |||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcct |
14738653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 16940764 - 16940810
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
16940764 |
ctaacatatggttttggtccctgcaaatatgcctcggtttggtttta |
16940810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 20355768 - 20355722
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
20355768 |
ctaaaatatggttttagtccccgtaaatatgtttcgttttagtttta |
20355722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 263 - 293
Target Start/End: Complemental strand, 21554652 - 21554622
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21554652 |
gaaaatagtccctgaccccacttttgtgatg |
21554622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 29198305 - 29198351
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
29198305 |
ctaaaatatggttttggtccctgcaaatatatctcgttttggtttta |
29198351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 30223463 - 30223509
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||| |||||| |
|
|
| T |
30223463 |
ctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
30223509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 35470286 - 35470232
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||| ||||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
35470286 |
attttaggctaaaatttggttttgatccctgcaaatatgcctcattttggtttta |
35470232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 39439027 - 39438981
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||| |||||| |
|
|
| T |
39439027 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
39438981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44568328 - 44568374
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
44568328 |
ctaaaatatggttttggtccctgcaaatataactcgttttggtttta |
44568374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44568688 - 44568642
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
44568688 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44568642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 44841359 - 44841397
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgtttt |
44841397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 45228617 - 45228663
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| | ||| |||||||||||||||||| |||||| |
|
|
| T |
45228617 |
ctaaaatatggttttgggccccgcaaatatgcctcgtttttgtttta |
45228663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46304382 - 46304336
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
46304382 |
ctaaaatatagttttagtccctgcaaatatgtttcgttttggtttta |
46304336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46759940 - 46759894
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
46759940 |
ctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
46759894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 46828946 - 46828992
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||| |||||| |
|
|
| T |
46828946 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttggtttta |
46828992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 34877777 - 34877822
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| |||||||| |||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggtttta |
34877822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 37953048 - 37953003
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || ||||| |||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
37953003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 206
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
166 |
aatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 488814 - 488846
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
488814 |
gaaaatagtctctgaccccacttttgtgatgat |
488846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 5308586 - 5308554
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
5308586 |
gaaaatagtctctgaccccacttttgtgatgat |
5308554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 6954862 - 6954906
Alignment:
| Q |
164 |
aaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggtttta |
6954906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 12894301 - 12894269
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
12894301 |
gaaaatagtccatgaccccacttttgtgatgat |
12894269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 19561249 - 19561281
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
19561249 |
gaaaatagtccctgacaccacttttgtgatgat |
19561281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 19783916 - 19783948
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
19783916 |
gaaaatagtccctgatcccacttttgtgatgat |
19783948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 21223508 - 21223540
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
21223508 |
gaaaatagtctctgaccccacttttgtgatgat |
21223540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 22871162 - 22871194
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
22871162 |
gaaaatagaccctgaccccacttttgtgatgat |
22871194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 168 - 208
Target Start/End: Original strand, 24953828 - 24953868
Alignment:
| Q |
168 |
tatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggtttta |
24953868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 207
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||| ||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 31732350 - 31732318
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
31732350 |
gaaaatagtccctgaccccatttttgtgatgat |
31732318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 35014924 - 35014956
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaa |
188 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
35014924 |
tttaggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 35015118 - 35015086
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
35015118 |
gaaaatagttcctgaccccacttttgtgatgat |
35015086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 38486794 - 38486742
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||| |||||| |||||| |
|
|
| T |
38486794 |
tttaggctaaaatatggttttgatccctgtaaatatgccccgttttggtttta |
38486742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 39833005 - 39833037
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
39833005 |
gaaaatagttcctgaccccacttttgtgatgat |
39833037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 44344690 - 44344658
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
44344690 |
gaaaatagtcactgaccccacttttgtgatgat |
44344658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 44403151 - 44403119
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
44403151 |
gaaaatagtctctgaccccacttttgtgatgat |
44403119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 45073541 - 45073509
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
45073541 |
gaaaatagtctctgaccccacttttgtgatgat |
45073509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 46304281 - 46304249
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
46304281 |
gaaaatagtctctgaccccacttttgtgatgat |
46304249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 204)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 22099545 - 22099598
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
22099545 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
22099598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 35415641 - 35415576
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
35415641 |
atatttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 152 - 217
Target Start/End: Original strand, 35763639 - 35763704
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
35763639 |
atatattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 55072709 - 55072660
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatcc |
55072660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 32365090 - 32365142
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32365090 |
tttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32365142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 23778966 - 23779021
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| | |||||| |
|
|
| T |
23778966 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttggt |
23779021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 41345855 - 41345910
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
41345855 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 52430103 - 52430052
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52430103 |
ttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagtttta |
52430052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 155 - 201
Target Start/End: Original strand, 13064154 - 13064200
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13064154 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
13064200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13064463 - 13064417
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13064463 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
13064417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 16712689 - 16712643
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16712689 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
16712643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 18205158 - 18205204
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18205158 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18205204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 32208544 - 32208590
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32208544 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
32208590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45505892 - 45505846
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45505892 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
45505846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 52017507 - 52017553
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52017507 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 52017868 - 52017822
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52017868 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
52017822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 53717172 - 53717126
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
53717172 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
53717126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 5052578 - 5052529
Alignment:
| Q |
166 |
aatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
5052578 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagtccttg |
5052529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 154 - 215
Target Start/End: Complemental strand, 13074131 - 13074070
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
13074131 |
attttaggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttg |
13074070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 20144423 - 20144468
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagtttta |
20144468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 29380908 - 29380855
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
29380908 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
29380855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 29463911 - 29463866
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29463911 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 34361805 - 34361858
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
34361805 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
34361858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 38054549 - 38054594
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
38054594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 46088069 - 46088012
Alignment:
| Q |
151 |
aatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
46088069 |
aataatttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
46088012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 51545966 - 51545921
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
51545921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 153 - 217
Target Start/End: Original strand, 50714233 - 50714297
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||| |||| |||||| ||| |||| |
|
|
| T |
50714233 |
tatttttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 50714563 - 50714432
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
50714563 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaattttttgtttt |
50714466 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
50714465 |
tgaaaatagtccctgaccccacttttgtgatgat |
50714432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 123536 - 123591
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| ||| |||| |
|
|
| T |
123536 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 6827872 - 6827817
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
6827872 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6827817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 9289268 - 9289323
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
9289268 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 41346216 - 41346161
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |||||| |||||||| |
|
|
| T |
41346216 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggt |
41346161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 51708690 - 51708741
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
51708690 |
ttaggctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
51708741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 2034853 - 2034807
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
2034853 |
ctaaaatatggttttagtcccagcaaatatgcctcgttttggtttta |
2034807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2180222 - 2180268
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
2180222 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
2180268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 6827548 - 6827594
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
6827548 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
6827594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 200
Target Start/End: Complemental strand, 8191389 - 8191351
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8191389 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
8191351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 9445951 - 9445997
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
9445997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 11285505 - 11285551
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11285505 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
11285551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13479274 - 13479320
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
13479274 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13479609 - 13479563
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
13479609 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13530711 - 13530665
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
13530711 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
13530665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18205521 - 18205475
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
18205475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 22099910 - 22099864
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
22099910 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
22099864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 23245233 - 23245279
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
23245233 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
23245279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 24474961 - 24474915
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24474961 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
24474915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24774047 - 24774093
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
24774047 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
24774093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 27008086 - 27008132
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27008086 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
27008132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 28809178 - 28809132
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28809178 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
28809132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 29499184 - 29499230
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29499184 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 30046790 - 30046744
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
30046790 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30046744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 30061131 - 30061085
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
30061131 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
30061085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 32365481 - 32365435
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32365481 |
ctaaaatatggttttagtccctgcaaatatggctcgttttggtttta |
32365435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 35464380 - 35464334
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35464380 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
35464334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 42848389 - 42848343
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
42848389 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
42848343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 43231387 - 43231341
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
43231387 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
43231341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 45505602 - 45505648
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
45505602 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
45505648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 46115416 - 46115462
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
46115416 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46115462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 46128550 - 46128596
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
46128550 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
46128596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46292649 - 46292603
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
46292649 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
46292603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 51545631 - 51545677
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
51545631 |
ctaaaatatggttttagtccctgcaaatatacctcgttttggtttta |
51545677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 51709025 - 51708979
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
51709025 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
51708979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 55072391 - 55072437
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
55072391 |
ctaaaatatggttttagtccctgcaaatatgcttcgttttggtttta |
55072437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 4211563 - 4211608
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4211563 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
4211608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 4279333 - 4279280
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
4279333 |
ctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttg |
4279280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 9289647 - 9289582
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||| ||| || |||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
9289647 |
atattctaggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 14487804 - 14487849
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
14487804 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 29499543 - 29499498
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
29499498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Original strand, 35464013 - 35464066
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
35464013 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
35464066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 45593591 - 45593538
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
45593591 |
ttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggtttta |
45593538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 46292394 - 46292439
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
46292394 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 53716923 - 53716976
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |||||| |
|
|
| T |
53716923 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttg |
53716976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 5882548 - 5882599
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
5882548 |
tttaggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggtttta |
5882599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 12791978 - 12791926
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
12791978 |
tttaggctaaaatatgatttttgtccctgcaaatatgcctcgttttggtttta |
12791926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Original strand, 13631224 - 13631276
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
13631224 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13631276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 26412592 - 26412536
Alignment:
| Q |
152 |
atattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| | ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
26412592 |
atatttttggctaaaatatggttttggtccctgcaaatatggctcgttttggtttta |
26412536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 29463612 - 29463660
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
29463612 |
ctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaat |
29463660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 123893 - 123850
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggtttta |
123850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 153 - 208
Target Start/End: Original strand, 4279015 - 4279070
Alignment:
| Q |
153 |
tattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
4279015 |
tattttaggctaaaatatggttttagcccctgcaaatatatctcgttttggtttta |
4279070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 16712331 - 16712370
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgtttt |
16712370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 165 - 208
Target Start/End: Complemental strand, 27008401 - 27008358
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggtttta |
27008358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 32208899 - 32208860
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32208899 |
ctaaaatatggttttaatccctgcaaatatgcctcgtttt |
32208860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 35415301 - 35415356
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| |||||| ||| |||| |
|
|
| T |
35415301 |
ctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
35415356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 35763953 - 35763898
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||| |||||| ||| |||| |
|
|
| T |
35763953 |
ctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggt |
35763898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 36702002 - 36702041
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36702002 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
36702041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 41620254 - 41620199
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||| |||||| ||| |||| |
|
|
| T |
41620254 |
ctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
41620199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 52441765 - 52441804
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52441765 |
ctaaaatatggttttagtccctgcaaatatgtctcgtttt |
52441804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 53915685 - 53915724
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53915685 |
ctaaaatatggttttggtccctgcaaatatgcctcgtttt |
53915724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2322095 - 2322141
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
2322095 |
ctaaaatatggttttggtccctacaaatatgcctcgttttggtttta |
2322141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 5202929 - 5202967
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
5202967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 5827971 - 5827925
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
5827971 |
ctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
5827925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 6353636 - 6353590
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
6353636 |
ctaaaatatggttttggtccctgcaaatatacctcgttttggtttta |
6353590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 8760779 - 8760733
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
8760779 |
ctaaaatatggttttagtccttgcaaatatggctcgttttggtttta |
8760733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8904888 - 8904934
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
8904888 |
ctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 12152156 - 12152202
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
12152156 |
ctaaaatatggttttggtccctgcaaatatgactcgtttaagtttta |
12152202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 13073761 - 13073807
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
13073761 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
13073807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 13631597 - 13631551
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
13631597 |
ctaaaatatggttttggtccctgcaaatatgactcgttttggtttta |
13631551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 14791804 - 14791758
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
14791804 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
14791758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 15555636 - 15555590
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
15555636 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttggtttta |
15555590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 19903653 - 19903607
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
19903607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 20291988 - 20292034
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
20291988 |
ctaaaatatgattttggtccctgcaaatatgcctcgttttggtttta |
20292034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 22584289 - 22584335
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
22584289 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
22584335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 25423926 - 25423972
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
25423926 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25423972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 25424310 - 25424264
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
25424310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
25424264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28448836 - 28448882
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
28448836 |
ctaaaatatggttttagtccttacaaatatgcctcgttttggtttta |
28448882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 29420535 - 29420489
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
29420535 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
29420489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 30060772 - 30060810
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgtttt |
30060810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 36702361 - 36702315
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
36702361 |
ctaaaatatggttttagttcctgcagatatgcctcgttttggtttta |
36702315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 42823770 - 42823824
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||||||||| |||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
42823770 |
attttaggctaaaatatgattttggtccctgcaaatatgtctcgttttggtttta |
42823824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 43231090 - 43231136
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
43231090 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
43231136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 43368467 - 43368513
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggtttta |
43368513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 45474594 - 45474548
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
45474594 |
ctaaaatatggttttagtccctgcaaatatgcttcgctttggtttta |
45474548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46115777 - 46115731
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
46115777 |
ctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46115731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 46128911 - 46128865
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| |||||| |
|
|
| T |
46128911 |
ctaaaatatggttttagtccctgcaaatacgtctcgttttggtttta |
46128865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 52442090 - 52442044
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
52442090 |
ctaaaatatggttttagtccttgcaaatatgtctcgttttggtttta |
52442044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 53916045 - 53915999
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
53916045 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
53915999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 54903473 - 54903427
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
54903473 |
ctaaaatatggttttggtccctgcaaatatgccccgttttggtttta |
54903427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 55482466 - 55482420
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
55482466 |
ctaaaatatgattttagtccctccaaatatgcctcgttttggtttta |
55482420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 2180570 - 2180517
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | |||||| |||||| |||||| |
|
|
| T |
2180570 |
ctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttg |
2180517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 5797817 - 5797768
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||| |||||| |||||||| |||||||| |||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatcc |
5797768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 12152491 - 12152446
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
12152491 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 14791502 - 14791547
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
14791547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 207
Target Start/End: Original strand, 29380670 - 29380715
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
29380670 |
ctaaaatatagttttagtccctgcaaatatgtctcgttttggtttt |
29380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 47136169 - 47136116
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |||||| |
|
|
| T |
47136169 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttg |
47136116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 156 - 201
Target Start/End: Complemental strand, 51738415 - 51738370
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
51738415 |
tttaggctaaaatatggttttggtccatgcaaatatgcctcgtttt |
51738370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 54208822 - 54208777
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
54208777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 9446223 - 9446191
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9446223 |
gaaaatagtccctgaccccacttttgtgatgat |
9446191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 13479371 - 13479403
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13479371 |
gaaaatagtccctgaccccacttttgtgatgat |
13479403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 206
Target Start/End: Original strand, 13764615 - 13764659
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
13764615 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttt |
13764659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 14488191 - 14488139
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
14488191 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
14488139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 22584611 - 22584559
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||| ||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
22584611 |
tttaggctaaaatgtggttttagtctctgcaaatatgcttcgttttggtttta |
22584559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 27427944 - 27427976
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27427944 |
gaaaatagtccctgaccccacttttgtgatgat |
27427976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 36702101 - 36702133
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36702101 |
gaaaatagtccctgaccccacttttgtgatgat |
36702133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 41921095 - 41921031
Alignment:
| Q |
149 |
caaatattttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||| |||| || ||||||||||||||||| ||||||||||||| ||||||| |||||| |||| |
|
|
| T |
41921095 |
caaagatttaaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcct |
41921031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 45593225 - 45593269
Alignment:
| Q |
157 |
ttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
45593225 |
ttaggctaaaatatagttttagtccctacaaatatgcctcgtttt |
45593269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 55482369 - 55482337
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55482369 |
gaaaatagtccctgaccccacttttgtgatgat |
55482337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 2034544 - 2034587
Alignment:
| Q |
165 |
aaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggtttta |
2034587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 11693119 - 11693080
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11693119 |
ctaaaatatggttttggtccctgcaaatatgtctcgtttt |
11693080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 209
Target Start/End: Complemental strand, 20144729 - 20144682
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaa |
209 |
Q |
| |
|
||||||||||||||| || | ||||||||||||||||||| ||||||| |
|
|
| T |
20144729 |
ctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaa |
20144682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 37557193 - 37557154
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
37557193 |
ctaaaatatggttttggtccctgcaaatatacctcgtttt |
37557154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 54903114 - 54903161
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| |||||||||||||||| |
|
|
| T |
54903114 |
taaaatatggttttgatccctacaaatatgcatcgttttagttttaat |
54903161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 2322430 - 2322384
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
2322430 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
2322384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5827657 - 5827703
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
5827657 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
5827703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8760606 - 8760652
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
8760606 |
ctaaaatatagttttactccctgcaaatatgtctcgttttggtttta |
8760652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 8905232 - 8905182
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
8905232 |
ctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatcc |
8905182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 295
Target Start/End: Original strand, 13064260 - 13064290
Alignment:
| Q |
265 |
aaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13064260 |
aaatagtccctgaccccacttttgtgatgat |
13064290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 14594201 - 14594259
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||| ||| |||||| |||| |
|
|
| T |
14594201 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcct |
14594259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 18831176 - 18831130
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||| |||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggtttta |
18831130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 19321857 - 19321811
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
19321857 |
ctaaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
19321811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 23245593 - 23245547
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
23245593 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
23245547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 23779223 - 23779177
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| |||| |||||| |
|
|
| T |
23779223 |
ctaaaatatggttttaatccctgcaaatatgtctcattttggtttta |
23779177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24474602 - 24474647
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
24474602 |
ctaaaatatggttttagt-cctgcaaatatgcatcgttttggtttta |
24474647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 26412192 - 26412238
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
26412192 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
26412238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 27427874 - 27427919
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
27427874 |
ctaaaatatggttt-agtccctgcaaatatggctcgttttggtttta |
27427919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 28449212 - 28449162
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| ||||||||| |
|
|
| T |
28449212 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatcc |
28449162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 28809013 - 28809059
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
28809013 |
ctaaaatatggttttagtccttgcaaatatgtatcgttttggtttta |
28809059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 192
Target Start/End: Original strand, 30564835 - 30564865
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatg |
30564865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31370806 - 31370852
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
31370806 |
ctaaaatatggttttagtgtctgcgaatatgcctcgttttggtttta |
31370852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 31560333 - 31560379
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
31560333 |
ctaaaatatggttttgatccctgcaaatatgcttcgttttggtttta |
31560379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 31560693 - 31560647
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||| |||||| |
|
|
| T |
31560693 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
31560647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 31812211 - 31812165
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||| |
|
|
| T |
31812211 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
31812165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 34355281 - 34355235
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
34355281 |
ctaaaatatggttttagtccctcaaaatatgactcgttttggtttta |
34355235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 35119294 - 35119340
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
35119294 |
ctaaaatatggttttggtccctgcaaatatgctccgttttggtttta |
35119340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 158 - 208
Target Start/End: Original strand, 35420389 - 35420439
Alignment:
| Q |
158 |
tagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||| | ||||| |||||| |
|
|
| T |
35420389 |
tagtctaaaatatggttttggtccccgcaaatatgctttgttttggtttta |
35420439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 36050290 - 36050336
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||| |||||| |
|
|
| T |
36050290 |
ctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
36050336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 36054148 - 36054102
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
36054148 |
ctaaaatacggttttggtccctgcaaatatgcctcattttggtttta |
36054102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 41324888 - 41324842
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
41324888 |
ctaaaatatggttttgatctctgcaaatatgcctcgttttggtttta |
41324842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 201
Target Start/End: Original strand, 41920771 - 41920809
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcatttt |
41920809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 42848029 - 42848075
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||||||| |||||| |
|
|
| T |
42848029 |
ctaaaatatggttttggttcctgcaaatatgtctcgttttggtttta |
42848075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 44925487 - 44925533
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
44925487 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
44925533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 44925843 - 44925797
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||||| |||||| |
|
|
| T |
44925843 |
ctaaaatatggttttggtctccgcaaatatgcctcgttttggtttta |
44925797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 47274228 - 47274182
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
47274228 |
ctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
47274182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 51738139 - 51738185
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||| |||||| |
|
|
| T |
51738139 |
ctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 51763200 - 51763154
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
51763200 |
ctaaaatatagttttggtccctgcaaatatgcctcattttggtttta |
51763154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 52543424 - 52543470
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
52543424 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Complemental strand, 52543725 - 52543675
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||| |||| || | ||||||||||||||||||| |||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatcc |
52543675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 53308066 - 53308020
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| |||||| |
|
|
| T |
53308066 |
ctaaaatatggttttggtccctgcaaatatgtcccgttttggtttta |
53308020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Original strand, 7639898 - 7639947
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||||||||||| |||||| |||||||| || ||||| ||||||||| |
|
|
| T |
7639898 |
ctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatc |
7639947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 9446321 - 9446276
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttt |
207 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
9446321 |
ctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 42824089 - 42824036
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||| ||||| |||||| |
|
|
| T |
42824089 |
ctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttg |
42824036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 47022743 - 47022788
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||| |||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
47022788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 51830888 - 51830937
Alignment:
| Q |
159 |
agtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| || ||||| |||||| |
|
|
| T |
51830888 |
agtctaaaatatagttttagtccctgcatatatgtcttgttttggtttta |
51830937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 4279233 - 4279201
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
4279233 |
gaaaatagtacctgaccccacttttgtgatgat |
4279201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 5063105 - 5063137
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
5063105 |
gaaaatagtccttgaccccacttttgtgatgat |
5063137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 6827772 - 6827740
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
6827772 |
gaaaatagtccctgatcccacttttgtgatgat |
6827740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 18136014 - 18135982
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
18136014 |
gaaaatagtcactgaccccacttttgtgatgat |
18135982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 24474861 - 24474829
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
24474861 |
gaaaatagtccctgaccccacttttctgatgat |
24474829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 27008306 - 27008274
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
27008306 |
gaaaatagtctctgaccccacttttgtgatgat |
27008274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 29463812 - 29463780
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
29463812 |
gaaaatagtccctgaccccatttttgtgatgat |
29463780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 31182502 - 31182458
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||||| |||| |
|
|
| T |
31182502 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttt |
31182458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 34355065 - 34355097
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
34355065 |
gaaaatagtccctggccccacttttgtgatgat |
34355097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 34362044 - 34362012
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
34362044 |
gaaaatagtccttgaccccacttttgtgatgat |
34362012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 206
Target Start/End: Complemental strand, 35119609 - 35119565
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttt |
206 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||| |||| |
|
|
| T |
35119609 |
ctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 35415401 - 35415433
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
35415401 |
gaaaatagtccctgactccacttttgtgatgat |
35415433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 38054646 - 38054678
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
38054646 |
gaaaatagtccctgatcccacttttgtgatgat |
38054678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 41346117 - 41346085
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
41346117 |
gaaaatagtccctgaccccatttttgtgatgat |
41346085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 41620154 - 41620122
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
41620154 |
gaaaatagtccctgactccacttttgtgatgat |
41620122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 41920983 - 41920951
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
41920983 |
gaaaatagtccctgaccctacttttgtgatgat |
41920951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 45619795 - 45619759
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgcaaatat |
45619759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 49123222 - 49123190
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
49123222 |
gaaaatagtcactgaccccacttttgtgatgat |
49123190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 51708926 - 51708894
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
51708926 |
gaaaatagtccctgatcccacttttgtgatgat |
51708894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 51831002 - 51830974
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51831002 |
taaaatatggttttagtccctgcaaatat |
51830974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 2780 - 2826
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2780 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
2826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5211 - 5257
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5211 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 5311 - 5343
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
5311 |
gaaaatagtcactgaccccacttttgtgatgat |
5343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5231 - 5277
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5231 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 5331 - 5363
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
5331 |
gaaaatagtcactgaccccacttttgtgatgat |
5363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 8734 - 8780
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 9026 - 8980
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9026 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 14699 - 14745
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14699 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
14745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 15010 - 14964
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |||||| |
|
|
| T |
15010 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggtttta |
14964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 14797 - 14829
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
14797 |
gaaaatagtccctggccccacttttgtgatgat |
14829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 366271 - 366225
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
366271 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
366225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 365981 - 366027
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
365981 |
ctaaaatatggttttaatccttgcaaatatgcctcgttttggtttta |
366027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 94059 - 94109
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
94059 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatcc |
94109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 210
Target Start/End: Complemental strand, 94328 - 94280
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaat |
210 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
94328 |
ctaaaatatggttttagtccctacaaatatgcctcgttttggttttaat |
94280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 4310 - 4257
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| | |||||| |
|
|
| T |
4310 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttg |
4257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 208
Target Start/End: Original strand, 4016 - 4057
Alignment:
| Q |
167 |
atatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggtttta |
4057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 12527 - 12580
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
12527 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
12580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 3534 - 3587
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
3534 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttg |
3587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3916 - 3870
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
3916 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggtttta |
3870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 287 - 156
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
287 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaattttttgtttt |
190 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
189 |
tgaaaatagtccctgaccccacttttgtgatgat |
156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 75768 - 75716
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
75768 |
tttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
75716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 75353 - 75407
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
75353 |
attttaggctaaaatatggttttgctccctgcaaatatgtctcgttttggtttta |
75407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 1313 - 1368
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||| |||| |
|
|
| T |
1313 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 1642 - 1587
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
1642 |
ctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 1542 - 1510
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1542 |
gaaaatagtctctgaccccacttttgtgatgat |
1510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 295
Target Start/End: Original strand, 8549 - 8681
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
8549 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa-tttgtttttggtccctgcaaaattttttgtttt |
8647 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
8648 |
tgaaaatagtccctgatcccacttttgtgatgat |
8681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Original strand, 34933 - 34988
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||| ||| |||| |
|
|
| T |
34933 |
ctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 35170 - 35138
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
35170 |
gaaaatagtccttgaccccacttttgtgatgat |
35138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 10170 - 10221
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
10170 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcct |
10221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 10513 - 10467
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |
|
|
| T |
10513 |
ctaaaatatggttttagtccctgcaaatatgtctggttttggtttta |
10467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 10257 - 10289
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10257 |
gaaaatagtccctgaccccacttttgtgatgat |
10289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 18048 - 18002
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18048 |
ttttaggctaaaatatggttttagtccctgcgaatatgcctcgtttt |
18002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 17942 - 17910
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17942 |
gaaaatagtccctgaccccacttttgtgatgat |
17910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 200
Target Start/End: Complemental strand, 17964 - 17926
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17964 |
ctaaaatatggttttagtccctgcaaatatgcctcgttt |
17926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 54817 - 54863
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
54817 |
ctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
54863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 50075 - 50030
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
50030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 55176 - 55131
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
55131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 5401 - 5447
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
5401 |
ctaaaatatggttttagtccctgcaaatatgccttgttttggtttta |
5447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 162 - 295
Target Start/End: Complemental strand, 5706 - 5573
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttggtnnnnnnnnnnntttgtttttggtccctgcaaaannnnnnnnnnn |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
5706 |
ctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaattttttgtttt |
5607 |
T |
 |
| Q |
262 |
ngaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| |
|
|
| T |
5606 |
tgaaaatagtccccgaccccacgtttgtgatgat |
5573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 82704 - 82658
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
82704 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttta |
82658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 82343 - 82389
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| | |||||||| |||||| |
|
|
| T |
82343 |
ctaaaatatggttttggtccctgcaaatacgtctcgttttggtttta |
82389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 208
Target Start/End: Complemental strand, 2665 - 2612
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
2665 |
ttttaggctaaaatatggttttggtccctgcaaatatgccttgttttggtttta |
2612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Original strand, 8332 - 8385
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
8332 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttg |
8385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 8640 - 8587
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
8640 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttg |
8587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Original strand, 8432 - 8464
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
8432 |
gaaaatagtccctgaccccatttttgtgatgat |
8464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 3295 - 3243
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
3295 |
tttaggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
3243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 263 - 295
Target Start/End: Complemental strand, 3191 - 3159
Alignment:
| Q |
263 |
gaaaatagtccctgaccccacttttgtgatgat |
295 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
3191 |
gaaaatagtctctgaccccacttttgtgatgat |
3159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 156 - 208
Target Start/End: Complemental strand, 27368 - 27316
Alignment:
| Q |
156 |
tttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
27368 |
tttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
27316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 154 - 215
Target Start/End: Original strand, 26994 - 27054
Alignment:
| Q |
154 |
attttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||| || |||| ||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
26994 |
attttaggctcaaatttggttttggtccctgcaaatatgtctcgtttt-gttttaatccttg |
27054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 24374 - 24420
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| |||||| |
|
|
| T |
24374 |
ctaaaatatggttttagtcactgcaaatatgtctcgttttggtttta |
24420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 3754 - 3804
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcc |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||| | ||||| |||||||||| |
|
|
| T |
3754 |
ctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatcc |
3804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 4077 - 4031
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4077 |
ctaaaatacggttttggtccctgcaaatatgtctcgttttagtttta |
4031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 35; Significance: 0.0000000001; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Original strand, 47927 - 47973
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
47927 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
47973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Complemental strand, 48228 - 48183
Alignment:
| Q |
163 |
taaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggtttta |
48183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 155 - 213
Target Start/End: Complemental strand, 223177 - 223119
Alignment:
| Q |
155 |
ttttagtctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatcct |
213 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||| ||| |||||| |||| |
|
|
| T |
223177 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcct |
223119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 148280 - 148234
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||| |
|
|
| T |
148280 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
148234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 215
Target Start/End: Complemental strand, 22053 - 22000
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatccttg |
215 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||| |||||| |||||| |
|
|
| T |
22053 |
ctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttg |
22000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 162 - 201
Target Start/End: Complemental strand, 2881 - 2842
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgtttt |
201 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
2881 |
ctaaaatatggttttggtccctgcaaatatgtctcgtttt |
2842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 208
Target Start/End: Complemental strand, 3453 - 3407
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagtttta |
208 |
Q |
| |
|
||||||||| |||||||| |||||||||||| |||||||| |||||| |
|
|
| T |
3453 |
ctaaaatatagttttagttcctgcaaatatgtctcgttttggtttta |
3407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 189676 - 189627
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
189676 |
ctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaatc |
189627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 44204 - 44155
Alignment:
| Q |
162 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttagttttaatc |
211 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| || |||| ||||||||| |
|
|
| T |
44204 |
ctaaaatatggctttggtccctgcaaatatgcttcattttggttttaatc |
44155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University