View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17542_low_1 (Length: 332)
Name: NF17542_low_1
Description: NF17542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17542_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 139 - 314
Target Start/End: Original strand, 23708768 - 23708942
Alignment:
| Q |
139 |
ctccttcattgtcttcagtcaaaaacaccagtctggagaggataagattcttcttttcttcctttttgttttgctttatgctatatccactttcaatgat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23708768 |
ctccttcattgtcttcagtcaaaaacaccagtctggagaggataagattcttcttttcttcctttttgttttgctttatgctatatccactttcaatgat |
23708867 |
T |
 |
| Q |
239 |
aaccccgcttgatggtctcttcactnnnnnnntctcttattgtcggtcaaagatgactatgaaacttgcttaattg |
314 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23708868 |
aaccccgcttgatggtttcttcac-aaaaaaatctcttattgtcggtcaaagatgactatgaaacttgcttaattg |
23708942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 35 - 75
Target Start/End: Original strand, 23708568 - 23708608
Alignment:
| Q |
35 |
atcaaaataacctcgtagggttcatcgtgtatgattgtacc |
75 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23708568 |
atcaaaataacctcgtagggttcattgtgtatgattgtacc |
23708608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University