View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17543_low_16 (Length: 372)
Name: NF17543_low_16
Description: NF17543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17543_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 108 - 372
Target Start/End: Original strand, 41824943 - 41825207
Alignment:
| Q |
108 |
ccgtcaccgcttcattgttttcacaagcttgaactatataagcagcatactagtatatcagtgtagtaccaaaatcaaagaaaaacaacgaaagtgtgtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41824943 |
ccgtcaccgcttcattgttttcacaagcttgaactatataagcagcatactagtatatcagtgtagtaccaaaatcaaagaaaaacaacgaaagtgtgtg |
41825042 |
T |
 |
| Q |
208 |
tcaggttcacaccattcaccatgtcattatcaaaatcaaaagctctattcttcatctttaaaatattgatgttgaatttcataacaccaatgatacatgc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825043 |
tcaggttcacaccattcaccatgtcattatcaaaatcaaaagctctattcttcatctttaaaatattgatgttgaatttcataacaccaatgatacatgc |
41825142 |
T |
 |
| Q |
308 |
atgtggtccatgcactcagccaaatccaccaccttaccacaaaccaccaagccatccaaaaccaa |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41825143 |
atgtggtccatgcactcagccaaatccaccaccttaccacaaaccaccgagccatccaaaaccaa |
41825207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University