View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17543_low_21 (Length: 294)
Name: NF17543_low_21
Description: NF17543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17543_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 52 - 276
Target Start/End: Original strand, 41825221 - 41825445
Alignment:
| Q |
52 |
tcacggcggaggaggaggaagaccaatagtcttacctcctccagtggttgttgtgccacccattatcgtcacaccaccactgcaaccacctccgacgatc |
151 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825221 |
tcacggcggaggaggaggaaggccaatagtgttacctcctccagtggttgttgtgccacccattatcgtcacaccaccactgcaaccacctccgacgatc |
41825320 |
T |
|
| Q |
152 |
atatatccaccgccaacaacccctcctgtttttcctccatcgagtccaaggacttgtccaattgatgcactcaagcttggactttgtttggatgttcttg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825321 |
atatatccaccgccaacaacccctcctgtttttcctcctccgagtccaaggacttgtccaattgatgcactcaagcttggactttgtttggatgttcttg |
41825420 |
T |
|
| Q |
252 |
gaggagttgttcatattgtaattgg |
276 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
41825421 |
gaggagttgttcatgttgtaattgg |
41825445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University