View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17543_low_25 (Length: 279)
Name: NF17543_low_25
Description: NF17543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17543_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 42314145 - 42313875
Alignment:
| Q |
1 |
taataacatcctctttctctct----ctccttctacatattcgtgagttttgattaagtgaaacgcacaatccatacccaccatgttcattgtaagttct |
96 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42314145 |
taataacatcctctttctctctttctctccttctacatattcgtgagttttgattaagtgaaacgcacaatccatatccaccatgttcattgtaagttct |
42314046 |
T |
 |
| Q |
97 |
ccaagttagattgttattatttatcattatcatgattattttggtagttaaatggtt-atttggcttatgtgtttgtatataggaattagattgtccgtc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42314045 |
ccaagttagattgttattatttatcattatcatgattattttggtagttaaatggttgttttggcttatgtgtttttatataggaattagattgtccgtc |
42313946 |
T |
 |
| Q |
196 |
cagtgtcaagaagcaattggcggagctgtttcgagaatctctgaaagcaactgtgcctagtgaacctgatg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42313945 |
cagtgtcaagaagcaattggcggagctgtttcgagaatctctgaaagcaactgtgcctagtgaacctgatg |
42313875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University