View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17543_low_30 (Length: 228)
Name: NF17543_low_30
Description: NF17543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17543_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 29336054 - 29336253
Alignment:
| Q |
17 |
aaataattttgaaccattgttttatagtttttaaatattatttaagctatatggaaaaaggnnnnnnn--cgtgttgttcacaagttcatttctgctgca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29336054 |
aaataattttgaaccattgttttatagtttttaaatattatttaagccat--ggaaaaaggtttttttttcgtgttgttcacaagttcatttctgctgca |
29336151 |
T |
 |
| Q |
115 |
tagtttattggcnnnnnnntacctttctaaaagcatgtgatt---attactttaaatatgggaccagagaattgatctgataaaagttttagccatatat |
211 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29336152 |
tagtttattggcaaaaaaatacatttctaaaagcatgtgatttaaattactttaaatatgggaccagtgaattgatctgataaaagttttagccatatat |
29336251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University