View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17543_low_9 (Length: 561)
Name: NF17543_low_9
Description: NF17543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17543_low_9 |
 |  |
|
| [»] scaffold0075 (2 HSPs) |
 |  |  |
|
| [»] scaffold0618 (1 HSPs) |
 |  |  |
|
| [»] scaffold0638 (2 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 9e-59; HSPs: 31)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 31364217 - 31364067
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31364217 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaaactaaaatttctagtaatggttggatttgctacaaagaaagttg |
31364118 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31364117 |
gagccgagcctgggcactagcccaggctagctgggggtggctccgcccctg |
31364067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 10715738 - 10715584
Alignment:
| Q |
22 |
caaaatctgcagga-aatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgct-acaaagaaagt |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
10715738 |
caaaatctgcagggcaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgcttacaaagaaagt |
10715639 |
T |
 |
| Q |
114 |
tggagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctgt |
167 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10715638 |
tggagccgagcctgggcactagcccaggctagctggggggtggctccgcccctgt |
10715584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 10929508 - 10929354
Alignment:
| Q |
22 |
caaaatctgcagga-aatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgct-acaaagaaagt |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
10929508 |
caaaatctgcagggcaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgcttacaaagaaagt |
10929409 |
T |
 |
| Q |
114 |
tggagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctgt |
167 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
10929408 |
tggagccgagcctgggcactagcccaggctagctggggggtggctccgcccctgt |
10929354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 4552267 - 4552116
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||||| |||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
4552267 |
caaaatctgcaggaaatacatttcctgcggaatttacacacaaatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacaaagaaagttg |
4552168 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
4552167 |
gagctgagcctgggcactagcccaggctagctgggggggggctccgcccctg |
4552116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 14 - 166
Target Start/End: Complemental strand, 40969314 - 40969155
Alignment:
| Q |
14 |
atcattgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaa |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |||||||| |||| |||||||||| |||||||||| |
|
|
| T |
40969314 |
atcattgacaaaatctgcagaaaatgtgtttcctgcagaatttacacaaaaatccgcaggaaaagctaaaaattctcataatggttggacttgctacaaa |
40969215 |
T |
 |
| Q |
108 |
gaaagttggagccgagcctggacactagccgaggctagctggggg-tggctccgcccctg |
166 |
Q |
| |
|
|||||||| ||| ||||||| |||||||| |||||||||||||| | |||||||||||| |
|
|
| T |
40969214 |
gaaagttgaagctgagcctgagcactagcccaggctagctgggggatagctccgcccctg |
40969155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 49 - 167
Target Start/End: Complemental strand, 32005969 - 32005845
Alignment:
| Q |
49 |
cggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggc |
142 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| ||||||| ||| |||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
32005969 |
cggaatttacacaaaaatccgcaggaaaagctaaaaattctaataatggtagggcttgctacaaagaaagttggagctgagcctgggcactagcccaggc |
32005870 |
T |
 |
| Q |
143 |
tagctgggggtggctccgcccctgt |
167 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32005869 |
tagctgggggtggctccgcccctgt |
32005845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 2017471 - 2017622
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||| | | |||||||||||||||||| |
|
|
| T |
2017471 |
caaaatctgcgggaaatacatttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagagcttgctacaaagaaagttg |
2017570 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2017571 |
gagctaagcctgggcactagcccaggctagctggggggtggctccgcccctg |
2017622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 22 - 126
Target Start/End: Original strand, 41972471 - 41972581
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
41972471 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaagttctagtaatggttcggcttgctacaaagaaagttg |
41972570 |
T |
 |
| Q |
116 |
gagccgagcct |
126 |
Q |
| |
|
|||| |||||| |
|
|
| T |
41972571 |
gagctgagcct |
41972581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 71 - 165
Target Start/End: Complemental strand, 1585736 - 1585642
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccct |
165 |
Q |
| |
|
|||||||| ||||||||||||| ||| |||||||||||||||||| ||| |||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1585736 |
agctaaaaattctagtaatggtagggcttgctacaaagaaagttgaagctgagcctgggcactagcccaggctagctgggggtggctccgcccct |
1585642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 4728640 - 4728477
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||| || |||||| |
|
|
| T |
4728640 |
caaaatctgcaggaaatgtgtttcctgcggaatttactcaaaaatccgcaggtaaatccgcaggaaaagctaaaaattctagtaatggtttggcttgcta |
4728541 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| | |||||||| |||||||||||||||||| |
|
|
| T |
4728540 |
caaagaaagttggagccgagtctgggcactagcccaagctagctggggggtggctccgcccctg |
4728477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 50383970 - 50383819
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| |||||||| |||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50383970 |
caaaatctgcaggaaatgtgtttcctgcaaaatttacgcaaacatccgcaggaaaagctaaaagttctagtaatggctgggcttgctacaaagaaagttg |
50383871 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
50383870 |
gagctgagcctgggccagtgcccaggctagctggggggtggctccgcccctg |
50383819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 71 - 166
Target Start/End: Complemental strand, 2576186 - 2576091
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||||||||||||||||| |||||||| |||||||| || |||||||||| |||||||||||||| |
|
|
| T |
2576186 |
agctaaaaattcttgtaatggttgggcttgctacaaagaaagttggagctgagcctgggcactagcccagactagctggggttggctccgcccctg |
2576091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 8901885 - 8901734
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| || || ||||| ||||| ||||| |||| || ||||||||||||||| |
|
|
| T |
8901885 |
caaaatctgcaggaaatgtgtttcctgcggagtttacacaaaaatctgcaggaaaagttaaaagttctaaaaatggctgggctttctacaaagaaagttg |
8901786 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctgt |
167 |
Q |
| |
|
|||| |||||||| | ||| || | |||||| ||||||||||||||||| |
|
|
| T |
8901785 |
gagctgagcctgggctagtgcccagacaagctggcggtggctccgcccctgt |
8901734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 25237658 - 25237603
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
25237658 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaattccgcaggtaaa |
25237603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 165
Target Start/End: Complemental strand, 49745121 - 49744972
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| | || ||||| |||||||||||| | | ||| || ||||||||||| |
|
|
| T |
49745121 |
caaaatctgcagaaaatgtgtttcctacggaatttacacaaaaatctacaggaaaaggtaaaacttctagtaatggctagacttgttataaagaaagttg |
49745022 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccct |
165 |
Q |
| |
|
|||| |||||||||| ||| || |||||||||| ||||||||||||| |
|
|
| T |
49745021 |
gagctgagcctggactagtgcccagactagctggggttggctccgcccct |
49744972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 19 - 166
Target Start/End: Complemental strand, 52373823 - 52373670
Alignment:
| Q |
19 |
tgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaag |
112 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||||||| || || ||||| ||||||||||| || | || ||| |||||||| |
|
|
| T |
52373823 |
tgacaaaatctgcaagaaatacgttttctgcggaatttacacaaaaatctgcagaaaaagttaaaagttctagtaatgactgagcttactataaagaaag |
52373724 |
T |
 |
| Q |
113 |
ttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||||| |||||||| | ||| || ||||||||||||||||||||||||| |
|
|
| T |
52373723 |
ttggagctgagcctgggctagtgcccagactagctgggggtggctccgcccctg |
52373670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 22 - 136
Target Start/End: Complemental strand, 46645685 - 46645553
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------------------agctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
46645685 |
caaaatctgcatgaaatgtgtttcctgcagaatttacacaaaaatccgcaggtaaatccgcagaaaaagctaaaaattctagtaatggttgggcttgcta |
46645586 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagc |
136 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||| |
|
|
| T |
46645585 |
caaaggaagttggagctgagcctgggcactagc |
46645553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 2521961 - 2522020
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
2521961 |
ttgataaaatctacaggaaatgtgtttcctgcggactttacacaaaaatccgcaggtaaa |
2522020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 14044439 - 14044384
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||| |||| |
|
|
| T |
14044439 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaaattcgcaggtaaa |
14044384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 71 - 168
Target Start/End: Complemental strand, 32828242 - 32828144
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggg-gtggctccgcccctgtg |
168 |
Q |
| |
|
|||||||| ||||||||||||||||| || ||||||||||| ||||||| |||||||| | ||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32828242 |
agctaaaagttctagtaatggttgggattactacaaagaaaattggagctgagcctgggctagtgcccaggctagctggggtttggctccgcccctgtg |
32828144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 22 - 71
Target Start/End: Complemental strand, 9694181 - 9694132
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
9694181 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaattccgca |
9694132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 2576252 - 2576204
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2576252 |
aaaatctgcaggaaatgtgtttcctgcggaatttatacaaaaattcgca |
2576204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 74 - 166
Target Start/End: Complemental strand, 9003580 - 9003488
Alignment:
| Q |
74 |
taaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||| |||| |||||| |||| |||||||||||||| ||||||| |||||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
9003580 |
taaaagttcttgtaatgactgggcttgctacaaagaaaattggagctgagcctggactagtgcctaggctagctgggggtggctacgcccctg |
9003488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 9003649 - 9003595
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
9003649 |
caaaatctgcaggaaatgtgtttcctgcggaatttaca-taaaatccgcaggtaaa |
9003595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 23 - 77
Target Start/End: Complemental strand, 10058618 - 10058564
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
10058618 |
aaaatctgctggaaatgtgtttcctgcggaatttacacaaaattccccaggtaaa |
10058564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 36947600 - 36947545
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||||| |||||||||||||| |||| |
|
|
| T |
36947600 |
caaaatccgcaggaaatatgtttcctgcagaatttatacaaaaatccgcaggtaaa |
36947545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 118
Target Start/End: Complemental strand, 50099922 - 50099820
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||| ||||| ||||| |||||| |||||||||||||||||||||| |||||||| |||||||||||||| || ||||||||||||||| |
|
|
| T |
50099922 |
caaaatttgcagaaaatgaatttcctacggaatttacacaaaaatccgcagaaaaagctaaaagctctagtaatggttgaacttactacaaagaaagttg |
50099823 |
T |
 |
| Q |
116 |
gag |
118 |
Q |
| |
|
||| |
|
|
| T |
50099822 |
gag |
50099820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 75 - 166
Target Start/End: Original strand, 15034566 - 15034658
Alignment:
| Q |
75 |
aaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||||||||| ||| |||| ||| | ||| ||||||| | ||||||||||||||||||| |
|
|
| T |
15034566 |
aaaagttctagtaatggttgggcttgttacaaagaaagttgaagctgagcttgggctagtgcccaggctagttggggggtggctccgcccctg |
15034658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 72 - 166
Target Start/End: Complemental strand, 25237590 - 25237495
Alignment:
| Q |
72 |
gctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||||||| ||||||||||| ||| || ||||||||||||||||||| |||||||| | || ||||||||| ||||||||||||||||||| |
|
|
| T |
25237590 |
gctaaaagttctagtaatgactggacttactacaaagaaagttggagctgagcctgggctagtgctcaggctagctggggggtggctccgcccctg |
25237495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 71 - 112
Target Start/End: Complemental strand, 10058552 - 10058511
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaag |
112 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
10058552 |
agctaaaaattctcgtaatggttgggcttgctacaaagaaag |
10058511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 31929065 - 31929114
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca |
71 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
31929065 |
caaaatttgcaggaaatgtgtttcttgcagaatttacaataaaatccgca |
31929114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 113; Significance: 6e-57; HSPs: 27)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 6e-57
Query Start/End: Original strand, 369 - 485
Target Start/End: Complemental strand, 34058211 - 34058095
Alignment:
| Q |
369 |
tttttgttagcttctattctcgctccaaaaatagatgtgtaattaatgttatacagttaatgtagattttgccgatatgtttttaatattgtcccatttt |
468 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34058211 |
tttttgttagcttctattctcgctccaaaaatagatgtgtaattaatgttatacagttaatgtagattttgccgatatatttttaatattgtcccatttt |
34058112 |
T |
 |
| Q |
469 |
ccttttaccttgctttt |
485 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34058111 |
ccttttaccttgctttt |
34058095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 270 - 378
Target Start/End: Complemental strand, 34058471 - 34058363
Alignment:
| Q |
270 |
aaggaaagaggggagaaaacgtgaaggaagtattggagatgagggagagaaggaaggtgaacgaagtaagaataaaggaaagagaaaatagcaattctgt |
369 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34058471 |
aaggaaagaggagagaaaacgtgaaggaagtattggagatgagggagagaaggaaggtgaacgaagtaagaataaaggaaagagaaaatagcaattctct |
34058372 |
T |
 |
| Q |
370 |
ttttgttag |
378 |
Q |
| |
|
||||||||| |
|
|
| T |
34058371 |
ttttgttag |
34058363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 27584047 - 27584198
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
27584047 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtttggcttgctacaaagaaagttg |
27584146 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||||| | |||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
27584147 |
gagccgagcctgggcgctagcccaggctagctggggggtggctccgcccctg |
27584198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 27460777 - 27460625
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca------gctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27460777 |
caaaatctgcaggaaatgtgtttccttcggaatttacacaaaaatccgcaagaaaagctaaaaattctagtaatggttgggcttgctacaaagaaagttg |
27460678 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctgt |
167 |
Q |
| |
|
|||| |||||||| |||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
27460677 |
gagctgagcctgggcactagcccatgctagctagggggtggctccgcccctgt |
27460625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 25007545 - 25007394
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25007545 |
caaaatctgcaggaaatacatttcttgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacaaagaaagttg |
25007446 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| || ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
25007445 |
gagctgagcctgggcattagcccaggctagctggggggtggctccgcccctg |
25007394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 37154024 - 37154175
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||| | | || ||||||||||||||| |
|
|
| T |
37154024 |
caaaatctgcaggaaatacatttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagagcttcctacaaagaaagttg |
37154123 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
37154124 |
gagctgagcctgggcactagcccaggctagctggggggtggctccgcccctg |
37154175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 44305493 - 44305342
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||||||||| || ||| || ||||||||||||||| |
|
|
| T |
44305493 |
caaaatctgcaggaaatacatttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaattgtagggcttcctacaaagaaagttg |
44305394 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
44305393 |
gagctgagcctgggcactagcccaggctagctggggggtggctccgcccctg |
44305342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 22 - 128
Target Start/End: Original strand, 25011570 - 25011682
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25011570 |
caaaatctgcagaaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgctacaaagaaagttg |
25011669 |
T |
 |
| Q |
116 |
gagccgagcctgg |
128 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
25011670 |
gagctgagcctgg |
25011682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 6331767 - 6331606
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg------------------cagctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6331767 |
caaaatctgtaggaaatgtgtttcctgcggaatttacacaaaaatccggaggtaaacccgcaggaaaagctaaaatttctagtaatggttgagtttgcta |
6331668 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|| |||||||||||||||||||||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
6331667 |
catagaaagttggagccgagcctgggcactagcccaggctagct-ggggtggctccgcccctg |
6331606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 14727411 - 14727247
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
14727411 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaactccgcaggtaaatccgcaggaaaagctaaaaattctagtaatggttggacttgcta |
14727312 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagc-tgggggtggctccgcccctgt |
167 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
14727311 |
caaagaaagttggagctgagcctgggcactagcccaggctagcttgggggtggctccgcccctgt |
14727247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 71 - 166
Target Start/End: Complemental strand, 8239305 - 8239210
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| ||||||||||||| ||| || ||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8239305 |
agctaaaaattctagtaatggtagggattactacaaagaaagttggagctgagcctgggcactagcccaggctagctgggggtggctccgcccctg |
8239210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 22 - 167
Target Start/End: Original strand, 31844654 - 31844818
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31844654 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatctgcaggtaaatccgtaggaaaagctaaaatttctagtaatggttgggtttgcta |
31844753 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctgt |
167 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
31844754 |
gaaagaaagttggagttgagcctgggcactagatcaggctagctggggggtggctccgcccctgt |
31844818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 22 - 165
Target Start/End: Original strand, 44238892 - 44239042
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaa-tccgca------gctaaaatttctagtaatggttgggtttgctacaaagaaagtt |
114 |
Q |
| |
|
|||||||| || |||||||||||||||| ||||||||| ||||| |||||| |||||||||||||||||||| |||| || |||||||||||||| |
|
|
| T |
44238892 |
caaaatctacaagaaatgtgtttcctgcagaatttacaaaaaaaatccgcaagaaaagctaaaatttctagtaatggctgggctttctacaaagaaagtt |
44238991 |
T |
 |
| Q |
115 |
ggagccgagcctggacactagccgaggctagctgggggtggctccgcccct |
165 |
Q |
| |
|
||||| |||||||| | ||| || |||||||||||||||||||||||| |
|
|
| T |
44238992 |
ggagctgagcctgggctagtgcccagactagctgggggtggctccgcccct |
44239042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 71 - 163
Target Start/End: Original strand, 33469030 - 33469121
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgccc |
163 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| | |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
33469030 |
agctaaaatttctagtaatggttgaatttgctataaagaaagttggagctgagcctaggcactagcccaggctagct-ggggtggctccgccc |
33469121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 25 - 166
Target Start/End: Complemental strand, 4774085 - 4773937
Alignment:
| Q |
25 |
aatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttggag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||| |||||||| |||||||||||| |||| |||||||||| ||| |||||| |
|
|
| T |
4774085 |
aatctgcaggaaatgtgtttcctgcggaatttacataaatatccgcaggaaaagctaaaagttctagtaatggctgggcttgctacaaaaaaaattggag |
4773986 |
T |
 |
| Q |
119 |
ccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||| |||| | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
4773985 |
ttgagtctgggctagtgcccaggctagctggggggtggctccgcccctg |
4773937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 22 - 128
Target Start/End: Complemental strand, 9527126 - 9527014
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||| |||||||||||| | ||||||||| ||||||||||| |||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
9527126 |
caaaatctgcaggagatgtgtttcctgtgaaatttacaccaaaatccgcaggaaaagctaaaagttctagtaatggctgggcttgctacaaagaaagttg |
9527027 |
T |
 |
| Q |
116 |
gagccgagcctgg |
128 |
Q |
| |
|
|||| | |||||| |
|
|
| T |
9527026 |
gagctgggcctgg |
9527014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 22 - 127
Target Start/End: Complemental strand, 24646134 - 24646024
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||| | |||||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
24646134 |
caaaatctgcaggaaatgtgtttcctacggaatgtacacaaaaatccacaggaaaagctaaaagttctagtaatggttgag-ttgctacaaagaaagttg |
24646036 |
T |
 |
| Q |
116 |
gagccgagcctg |
127 |
Q |
| |
|
||| ||||||| |
|
|
| T |
24646035 |
gagttgagcctg |
24646024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 48940446 - 48940499
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca |
71 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48940446 |
ttgacaaaatctgcatgaaatgtgtttcctgcggaatttacacaaaaatccgca |
48940499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 18 - 130
Target Start/End: Original strand, 4642100 - 4642218
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaa |
111 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| | |||||||| |||||||||| |||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
4642100 |
ttgacaaaatctgcaagaaatgtatttcctgtgaaatttacataaaaatccgcaggaaaagctaaaagttctagtaatggctgaacttgctacaaagaaa |
4642199 |
T |
 |
| Q |
112 |
gttggagccgagcctggac |
130 |
Q |
| |
|
|| ||||| |||||||||| |
|
|
| T |
4642200 |
gtcggagctgagcctggac |
4642218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 493 - 546
Target Start/End: Complemental strand, 34058039 - 34057986
Alignment:
| Q |
493 |
tacatggtggagagactttggaaggcgagtattttatgatacaacactatgaca |
546 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
34058039 |
tacatggtggagagactttgaagggcgagtattttatgatacaacactatgaca |
34057986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 30 - 166
Target Start/End: Original strand, 6802142 - 6802284
Alignment:
| Q |
30 |
gcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgag |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| ||| | || |||||||||||| || | |||||||||||||||| | || ||| |
|
|
| T |
6802142 |
gcaggaaatgtgtttcctgtggaatttacagaaaaatccgcaggaaaagcgagaagttctagtaatggctgagcttgctacaaagaaagtagaagttgag |
6802241 |
T |
 |
| Q |
124 |
cctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||| | ||| |||||||||||||||||||| ||||||| |
|
|
| T |
6802242 |
cctgggctagtgcccaggctagctgggggtggctctgcccctg |
6802284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 166
Target Start/End: Complemental strand, 49898441 - 49898345
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||||||||||| || ||| |||||||||||||||||| |||||||| | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
49898441 |
agctaaaacttctagtaatggctgaacttgttacaaagaaagttggagctgagcctgggctagtgcccaggctagctggggggtggctccgcccctg |
49898345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 65
Target Start/End: Complemental strand, 24745493 - 24745450
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaa |
65 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
24745493 |
caaaatctgcagaaaatgtgtttcctgcagaatttacacaaaaa |
24745450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 73 - 119
Target Start/End: Original strand, 1428471 - 1428517
Alignment:
| Q |
73 |
ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagc |
119 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
1428471 |
ctaaaaattctagtaatggtagggcttgctacaaagaaagttggagc |
1428517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 8239374 - 8239322
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgt--ttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||||||||||||||| |
|
|
| T |
8239374 |
caaaatctgcaggaaatatatatttcctgcggaatttacacaaaaatccgcag |
8239322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 22 - 71
Target Start/End: Complemental strand, 34459190 - 34459141
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca |
71 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
34459190 |
caaaatctgcaggaaatgtgtttcctacggaaattccacaacaatccgca |
34459141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 71 - 125
Target Start/End: Original strand, 48940517 - 48940571
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcc |
125 |
Q |
| |
|
|||||||| |||||||||||| | || ||||||||||||| |||||||| ||||| |
|
|
| T |
48940517 |
agctaaaagttctagtaatggcttggcttgctacaaagaatgttggagctgagcc |
48940571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 102; Significance: 2e-50; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 22 - 163
Target Start/End: Complemental strand, 24965114 - 24964966
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24965114 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgctacaaagaaagttg |
24965015 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctggg-ggtggctccgccc |
163 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
24965014 |
gagccgagcctgggcactagcccaggctagctgggtggtggctccgccc |
24964966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 28928141 - 28927990
Alignment:
| Q |
22 |
caaaatctgcagg-aaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagtt |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
28928141 |
caaaatctgcagggaaatgtgtttcctgcggaatttacacaaaactccgcaggaaaagctaaaaattctagtaatggttaggcttgctacaaagaaagtt |
28928042 |
T |
 |
| Q |
115 |
ggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
28928041 |
ggagccgagcctgggcactagcccagaatagctgggggtggctccgcccctg |
28927990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 27321884 - 27322034
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||| |||||| || ||||||||| |||| |||||||||||||| ||| |
|
|
| T |
27321884 |
caaaatttgcaggaaatgtgtttcctgcggaatttacataaaaatccgcaggaaaaactaaaagttttagtaatggctgggcttgctacaaagaaaattg |
27321983 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| || ||| |||||||||||||||||||||||||||| |
|
|
| T |
27321984 |
gagctgagcctgggcaagtgcccaggctagctgggggtggctccgcccctg |
27322034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 36406590 - 36406686
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| || |||||||| ||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36406590 |
agctaaaaattatagtaatgtttgggcttgctacaaagaaagttggagccgagcctgggcactagcccaggctagctggggggtggctccgcccctg |
36406686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 22 - 165
Target Start/End: Original strand, 34282931 - 34283081
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
34282931 |
caaaatctgcaggaaatgtgtttcctgcagaatttacactaaaatccgcaagaaaagctaaaagttctagtaatgactggacttgctacaaagaaagttg |
34283030 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccct |
165 |
Q |
| |
|
|||| |||||||| | ||| ||||||||| |||||||||||||||||| |
|
|
| T |
34283031 |
gagctgagcctgggctagtgcccaggctagctggggggtggctccgcccct |
34283081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 71 - 162
Target Start/End: Original strand, 3384120 - 3384211
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcc |
162 |
Q |
| |
|
|||||||| ||||| ||||||| || |||||||||||||||||||||| |||||||| ||||| || ||||||||||| |||||||||||| |
|
|
| T |
3384120 |
agctaaaaattctaataatggtaggacttgctacaaagaaagttggagctgagcctgggcactaacccaggctagctggaggtggctccgcc |
3384211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 20 - 166
Target Start/End: Complemental strand, 38214842 - 38214689
Alignment:
| Q |
20 |
gacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagt |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||||||| |||||||| |||||||| ||| ||| |||||||||||||| | |
|
|
| T |
38214842 |
gacaaaatctgcaggaaatgtgttttatgcagaatttacataaaaatccgcaggaaaagctaaaagttctagtattggctggacttgctacaaagaaaat |
38214743 |
T |
 |
| Q |
114 |
tggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||| ||||| || | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
38214742 |
tggagctgagcccgggctagtgcccaggctagctggggggtggctccgcccctg |
38214689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 13243175 - 13243120
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
13243175 |
caaaatctacaggaaatgtgtttcctgcggaatttacacaaaactccgcagataaa |
13243120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 36406523 - 36406573
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
36406523 |
caaaatctgcaggaaatgtgtttcctacggaatttacacaaatatccgcag |
36406573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 39431696 - 39431751
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
39431696 |
caaaatctgcacgaaatgtgtttcctacggaatttacacaaaactccgcaggtaaa |
39431751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 80 - 166
Target Start/End: Original strand, 21138156 - 21138243
Alignment:
| Q |
80 |
ttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| | ||| |||||||||| ||| | ||||||| ||||||||||||||||||| |
|
|
| T |
21138156 |
ttctagtaatggttaggcttgctacaaagaaagtagaagctgagcctggactaatgcctatgctagctggggggtggctccgcccctg |
21138243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 39431763 - 39431859
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| ||| |||||| | |||||||||||||||||||||||||| ||||| || | ||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
39431763 |
agctaaaagttcaagtaattgaagggtttgctacaaagaaagttggagctgagcccgggctagtgcccaggctagctggggggtggctctgcccctg |
39431859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 2e-50; HSPs: 40)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 22 - 171
Target Start/End: Complemental strand, 30249046 - 30248890
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||| |||||||||||||||||| |
|
|
| T |
30249046 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagaaaaagctaaaaattctagtaatagttgggcttgctacaaagaaagttg |
30248947 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctgtgtgt |
171 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
30248946 |
gagccgagcctgggcactagcccaggctagctggggggtggctccgcccctgagtgt |
30248890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 34444047 - 34443896
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||| ||| || ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
34444047 |
caaaatctgcaggaaatgcatttcttgcggaatttagacaaaaatccgcaggaaaagctacaaattctagtaatggtagggcttgctacaaagaaagttg |
34443948 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
34443947 |
gagctgagcctgggcactagcccaggctagctggggggtggctccgcccctg |
34443896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 35468984 - 35468821
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaat-ttctagtaatggttgggtttgct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||| ||||| |
|
|
| T |
35468984 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagaaaaatccgcagaaaaagctaaaaaattctagcaatggttgggcttgct |
35468885 |
T |
 |
| Q |
103 |
acaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35468884 |
acaaagaaagttggagccgagcctgggcactagcccaggctagctgggggtggctccgcccctg |
35468821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 15675394 - 15675232
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa------------------atttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| | |||||||||||||||||||||| | |
|
|
| T |
15675394 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaactccgcaggtaaatccgcagaaaaagttaaaaattctagtaatggttgggtttgcaa |
15675295 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15675294 |
caaagaaagttagagccgagcctgggcactagcccaggctagctgggggtggctccgcccctg |
15675232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 15503997 - 15503847
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||| || |||||||||||||| ||| |
|
|
| T |
15503997 |
caaaatctgcaggaaatgtgtttcctgcagaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttaggcttgctacaaagaaatttg |
15503898 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|| |||||||| | ||| || |||||| |||||||||||||||||| |
|
|
| T |
15503897 |
aaggtgagcctgggctagtgcccagactagcttggggtggctccgcccctg |
15503847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 33006988 - 33006824
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| | ||||||||||||||||||||| |
|
|
| T |
33006988 |
caaaatctgcaggaaatgtgtttcctacggaatttacacaaaaatccgcaggtaaatccgcaggaaaagctaaaaaatttagtaatggttgggtttgcta |
33006889 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagctg--ggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
33006888 |
caaagaaagttggagccgagcctgggcattagcccaggctagctgggggggtggctcctcccctg |
33006824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 71 - 162
Target Start/End: Complemental strand, 34846381 - 34846289
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctg-ggggtggctccgcc |
162 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
34846381 |
agctaaaaattctagtaatggtttgacttgctacaaagaaagttggagccgagcctgggcactagcccaggctagctggggggtggctccgcc |
34846289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 71 - 165
Target Start/End: Complemental strand, 2476430 - 2476335
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctg-ggggtggctccgcccct |
165 |
Q |
| |
|
|||||||| ||||||||||||| || |||||||||||||| ||||||| |||||||| |||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
2476430 |
agctaaaaattctagtaatggtaggacttgctacaaagaaaattggagctgagcctgggcactagcccaggctagctggggggaggctccgcccct |
2476335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 16667516 - 16667571
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16667516 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggtaaa |
16667571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 74 - 167
Target Start/End: Original strand, 1672579 - 1672672
Alignment:
| Q |
74 |
taaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctgt |
167 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||| ||||||| ||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
1672579 |
taaaagttctagtaatggttgggattgctacaaagaaaattggagctgagcctgagctagtgcccaggctagctgggggtggctccgcccctgt |
1672672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 23 - 168
Target Start/End: Original strand, 36234606 - 36234757
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttgg |
116 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| |||||||||| || ||||| ||||| |||||| |||| |||||||||||||| |||| |
|
|
| T |
36234606 |
aaaatctgcaggaaatgcgtttcctgctgaatttacataaaaatccgcatgaaaagttaaaagttctaataatggctgggcttgctacaaagaaaattgg |
36234705 |
T |
 |
| Q |
117 |
agccgagcctggacactagccgaggctagctgggggtggctccgcccctgtg |
168 |
Q |
| |
|
||| ||| |||| | | | |||||| |||||||||||||||||| |||| |
|
|
| T |
36234706 |
agctgagtctgggctagtgtccaggctaactgggggtggctccgcccatgtg |
36234757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 74 - 166
Target Start/End: Original strand, 14832864 - 14832955
Alignment:
| Q |
74 |
taaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||| || ||||||||||||| |||||||||| |||||||||||||||||||| ||||||| || |||||||||||| ||||||||||| |
|
|
| T |
14832864 |
taaaaattttagtaatggttggacttgctacaaa-aaagttggagccgagcctgggtactagcccagcttagctgggggtgactccgcccctg |
14832955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 17192688 - 17192740
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc |
70 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
17192688 |
ttgacaaaatctgcaggaaatgtatttcctgcggaattgacacaaaaatccgc |
17192740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 43228665 - 43228720
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
43228665 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaacatccgcaggtaaa |
43228720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 43228732 - 43228827
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||| |||||| |||||| | | ||| |||||||||||||||||||||||||||| |
|
|
| T |
43228732 |
agctaaaagttctagtaatggctgggcttgctacaaagaaaattggagttgagccttggctagtgcccaggctagctgggggtggctccgcccctg |
43228827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 13694852 - 13694766
Alignment:
| Q |
80 |
ttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| || |||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
13694852 |
ttctagtaatggatgggcttgctacaaagaaagttgaagttgagcctgggctagtgcccaggctagctgggggtggctccgcccctg |
13694766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 73 - 171
Target Start/End: Complemental strand, 37779688 - 37779590
Alignment:
| Q |
73 |
ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctgtgtgt |
171 |
Q |
| |
|
|||||| |||||||||||| || |||||||||||||| |||||| |||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37779688 |
ctaaaagttctagtaatggctgaacttgctacaaagaaaattggagttgagcctggactagtgcccaggctagctgggggtggctccgcccctgggtgt |
37779590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 71 - 166
Target Start/End: Complemental strand, 16567817 - 16567721
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||||||||||| ||| |||||||||||||| ||||||| |||||||| | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
16567817 |
agctaaaagttctagtaatggctggacttgctacaaagaaaattggagctgagcctgggctagtgcccaggctagctggggggtggctccgcccctg |
16567721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 24 - 72
Target Start/End: Complemental strand, 42989613 - 42989565
Alignment:
| Q |
24 |
aaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42989613 |
aaatccgcaggaaatgtgtttcctgcggaatttacacaaaaattcgcag |
42989565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 7162106 - 7162161
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||| ||| |||| |
|
|
| T |
7162106 |
caaaatctgcaggaaatgtgtttcctgtggaatttacataaaaatcctcaggtaaa |
7162161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 12267432 - 12267487
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
12267432 |
caaaatctacaggaaatgtgtttcttgcggaatttacataaaaatccgcaggtaaa |
12267487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 71 - 173
Target Start/End: Original strand, 13942872 - 13942975
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctggg-ggtggctccgcccctgtgt |
169 |
Q |
| |
|
|||| ||| ||||||||| || ||||||||||||||||||||||||| | |||||||| | ||| ||||||| |||| |||||||||||||||| || |
|
|
| T |
13942872 |
agctcaaagttctagtaaaggctgggtttgctacaaagaaagttggacctgagcctgggctagtgcccaggctagttgggaggtggctccgcccctgagt |
13942971 |
T |
 |
| Q |
170 |
gtga |
173 |
Q |
| |
|
|||| |
|
|
| T |
13942972 |
gtga |
13942975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 21069090 - 21069035
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||| ||||| |||| |
|
|
| T |
21069090 |
caaaatctgcaggaaatgtgtttcttgcggaatatacacaaaaatgcgcaggtaaa |
21069035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 34846448 - 34846401
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg |
69 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34846448 |
caaaatctgtaggaaatgtgtttactgcggaatttacacaaaaatccg |
34846401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 71 - 128
Target Start/End: Original strand, 7162173 - 7162230
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctgg |
128 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
7162173 |
agctaaaatttttagtaatggctgggcttgctacaaagaaaattggagctgagcctgg |
7162230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 71 - 128
Target Start/End: Original strand, 17192759 - 17192816
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctgg |
128 |
Q |
| |
|
|||||||| |||||||||||| || | |||||||||||||||||||||| |||||||| |
|
|
| T |
17192759 |
agctaaaagttctagtaatggctgagcttgctacaaagaaagttggagctgagcctgg |
17192816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 71 - 163
Target Start/End: Original strand, 32953757 - 32953850
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgccc |
163 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||| ||||||| |||||| | | ||| ||||||||| |||||||||||||||| |
|
|
| T |
32953757 |
agctaaaagttctagtaatggctgggcttgctacaaagaaaattggagctgagcctcggctagtgcccaggctagctggggggtggctccgccc |
32953850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 98 - 171
Target Start/End: Complemental strand, 37607454 - 37607381
Alignment:
| Q |
98 |
ttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctgtgtgt |
171 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37607454 |
ttgctacaaagaaaattggagttgagcctggactagtgcccaggctagctgggggtggctccgcccctgggtgt |
37607381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 32953690 - 32953734
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaat |
66 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
32953690 |
caaaatctgcaggaaatgtgtttcctacggaatttacataaaaat |
32953734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 767363 - 767316
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg |
69 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
767363 |
caaaacctgtaggaaatgtgtttcctgcggaatttatacaaaaatccg |
767316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 72 - 166
Target Start/End: Complemental strand, 21069022 - 21068927
Alignment:
| Q |
72 |
gctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggg-gtggctccgcccctg |
166 |
Q |
| |
|
||||||| ||||||||||||||||| || |||||||||||||| ||| ||||||| | ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
21069022 |
gctaaaaattctagtaatggttgggcttactacaaagaaagttagagttgagcctgagctagtgcccaggctagctggggtgtggctccgcccctg |
21068927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 71 - 118
Target Start/End: Complemental strand, 6900799 - 6900752
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggag |
118 |
Q |
| |
|
|||||||| |||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
6900799 |
agctaaaagttctagtaatggctgagcttgctacaaagaaagttggag |
6900752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 16567884 - 16567829
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| || ||| ||||| |||| |
|
|
| T |
16567884 |
caaaatctgtaggaaatgtgtttcctgcgaaatttacataacaattcgcaggtaaa |
16567829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 37607552 - 37607513
Alignment:
| Q |
20 |
gacaaaatctgcaggaaatgtgtttcctgcggaatttaca |
59 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
37607552 |
gacaaaatctgcaggaaatgtgtttcatacggaatttaca |
37607513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 37779759 - 37779720
Alignment:
| Q |
20 |
gacaaaatctgcaggaaatgtgtttcctgcggaatttaca |
59 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
37779759 |
gacaaaatctgcaggaaatgtgtttcatacggaatttaca |
37779720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 1672509 - 1672559
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||| |||||| ||||| |
|
|
| T |
1672509 |
caaaatctgcagaaaatatgtttcctgcggaatgtacataaaaattcgcag |
1672559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 7159624 - 7159669
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatc |
67 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
7159624 |
caaaatccgcaggaaacgtgtttcctgcggaatgtacaccaaaatc |
7159669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 71 - 119
Target Start/End: Original strand, 12267499 - 12267547
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagc |
119 |
Q |
| |
|
|||||||| |||||||||| | | || |||||||||||||||||||||| |
|
|
| T |
12267499 |
agctaaaagttctagtaattgctaggcttgctacaaagaaagttggagc |
12267547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 80 - 128
Target Start/End: Original strand, 16667592 - 16667640
Alignment:
| Q |
80 |
ttctagtaatggttgggtttgctacaaagaaagttggagccgagcctgg |
128 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| ||| |||| |
|
|
| T |
16667592 |
ttctagtaatggctggacttgctacaaagaaagttggagctgagtctgg |
16667640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 25 - 77
Target Start/End: Complemental strand, 37654878 - 37654826
Alignment:
| Q |
25 |
aatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||| ||||| |||| |
|
|
| T |
37654878 |
aatctgcaggaaatgtgtttcctatggaatttacataacaattcgcaggtaaa |
37654826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 97; Significance: 2e-47; HSPs: 18)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 41114903 - 41115054
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
41114903 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacgaaaatccgcaggaaaaactaaaaattctagtaatggttgagcttgctacaaagaaagttg |
41115002 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctggggg-tggctccgcccctg |
166 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
41115003 |
gagccgagcctgggcactagcccaggctagctgggggatggctccgcccctg |
41115054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 13203849 - 13203698
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13203849 |
caaaatctgcaggaaacgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgctacaaagaaagttg |
13203750 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
13203749 |
gagctgagcctgggcactagcccaggctagctggggggtggctccacccctg |
13203698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 22 - 167
Target Start/End: Original strand, 22572734 - 22572885
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
22572734 |
caaaatctgcaggaaatgtgtttcctggggaatttacacaaaaattcgcaggaaaagctaaatattctagtaatggttaggcttgctacaaagaaagttg |
22572833 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctgt |
167 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
22572834 |
gagctgagcctggacactagcccaggctagccgggggtggctccgccgctgt |
22572885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 22 - 137
Target Start/End: Original strand, 6799919 - 6800040
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
6799919 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagttaaaaattctagtaatggttgagcttgctacaaagaaagttg |
6800018 |
T |
 |
| Q |
116 |
gagccgagcctggacactagcc |
137 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
6800019 |
gagccgagcctgggcactagcc |
6800040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 22 - 130
Target Start/End: Complemental strand, 17148863 - 17148749
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||| || | |||||||||||||||||| |
|
|
| T |
17148863 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggtaaacctaaaagttatagtaatggctgagcttgctacaaagaaagttg |
17148764 |
T |
 |
| Q |
116 |
gagccgagcctggac |
130 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
17148763 |
gagctgagcctggac |
17148749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 22 - 118
Target Start/End: Original strand, 18299176 - 18299278
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18299176 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaagaaaagttaaaaattctagtaatggttgggcttgctacaaagaaagttg |
18299275 |
T |
 |
| Q |
116 |
gag |
118 |
Q |
| |
|
||| |
|
|
| T |
18299276 |
gag |
18299278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 22 - 118
Target Start/End: Complemental strand, 12000605 - 12000502
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaa-atccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||| |||||| ||| ||| ||||||||||||| |
|
|
| T |
12000605 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaacatccgcaggaaaagctaaaacttctactaatggctggacttgttacaaagaaagtt |
12000506 |
T |
 |
| Q |
115 |
ggag |
118 |
Q |
| |
|
|||| |
|
|
| T |
12000505 |
ggag |
12000502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 125
Target Start/End: Complemental strand, 29257448 - 29257339
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg------cagctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| || ||||| || || ||||| ||||| || ||||||||||||||| |
|
|
| T |
29257448 |
caaaatctgcaggaaatgtgtttcctgcgaaatttacacaaaaatccgaaggaaaaggtaaaaattttaataatgattgggctttctacaaagaaagttg |
29257349 |
T |
 |
| Q |
116 |
gagccgagcc |
125 |
Q |
| |
|
|||| ||||| |
|
|
| T |
29257348 |
gagctgagcc |
29257339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 71 - 128
Target Start/End: Complemental strand, 25562950 - 25562893
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctgg |
128 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
25562950 |
agctaaaagttctagtaatggttgggcttgctacaaagaaagttggagctgagcctgg |
25562893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 14 - 130
Target Start/End: Complemental strand, 2475917 - 2475790
Alignment:
| Q |
14 |
atcattgacaaaatctgcaggaaatgtgtttcctg-----cggaatttacacaaaaatccgca------gctaaaatttctagtaatggttgggtttgct |
102 |
Q |
| |
|
||||||| ||||||||||| |||||| ||||| || ||||||||||||||||||||||| ||||||| |||||||||||| |||| || || |
|
|
| T |
2475917 |
atcattggcaaaatctgcaagaaatgagtttcatgttgtgcggaatttacacaaaaatccgcaagacaagctaaaagttctagtaatggctgggcttcct |
2475818 |
T |
 |
| Q |
103 |
acaaagaaagttggagccgagcctggac |
130 |
Q |
| |
|
||||||||||||||||| ||| |||||| |
|
|
| T |
2475817 |
acaaagaaagttggagctgagtctggac |
2475790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 23 - 164
Target Start/End: Complemental strand, 41010556 - 41010409
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||| |||||||||| | || || |||||| |||||||| |
|
|
| T |
41010556 |
aaaatctgcaggaaatgtgtttcctgcagaatttatacaaaaatccgcagaaaaaactaaaagttctagtaatagctgaacttagtacaaaaaaagttgg |
41010457 |
T |
 |
| Q |
117 |
agccgagcctggacactagccgaggctagctgggggtggctccgcccc |
164 |
Q |
| |
|
||| ||| || ||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
41010456 |
agctgagtctagactagtgcccaggctagctggggttggctccgcccc |
41010409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 22 - 124
Target Start/End: Original strand, 304158 - 304264
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| ||||||| |||||| |||||||||||| || | |||||||||||||||||| |
|
|
| T |
304158 |
caaaatctgcaagaaatgtgtttcctgcgaaatttacacaac--tccgcaggaaaagctaaaagttctagtaatggctgagcttgctacaaagaaagttg |
304255 |
T |
 |
| Q |
116 |
gagccgagc |
124 |
Q |
| |
|
|||| |||| |
|
|
| T |
304256 |
gagctgagc |
304264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 23 - 166
Target Start/End: Original strand, 33909376 - 33909525
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttgg |
116 |
Q |
| |
|
|||||||||||||||||| | |||||| |||||| ||||||||| ||||| |||||| ||||||||||| || | ||||||||||||||||||| |
|
|
| T |
33909376 |
aaaatctgcaggaaatgtttctcctgcagaattttcacaaaaattcgcaggaaaaactaaaaattctagtaatgactgagcttgctacaaagaaagttgg |
33909475 |
T |
 |
| Q |
117 |
agccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||| || |||| | ||| ||| |||||| ||||||||||||||||| |
|
|
| T |
33909476 |
agctaagtctgggctagtgcccaggttagctgagggtggctccgcccctg |
33909525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 25563017 - 25562967
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| || ||||||||| |
|
|
| T |
25563017 |
caaaatctgcaggaaatgtatttcctgcggaatttacaaaacaatccgcag |
25562967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 15651281 - 15651247
Alignment:
| Q |
30 |
gcaggaaatgtgtttcctgcggaatttacacaaaa |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
15651281 |
gcaggaaatgtgtttcctgcggaatttacacaaaa |
15651247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 17249400 - 17249354
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatcc |
68 |
Q |
| |
|
|||||||| || ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17249400 |
caaaatctacaagaaatgtgtttcctgtggaatttacacaaaaatcc |
17249354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 69
Target Start/End: Complemental strand, 15429264 - 15429213
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg |
69 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
15429264 |
ttgacaaaatccacaggaaacatgtttcctgcggaatttacaccaaaatccg |
15429213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 166
Target Start/End: Complemental strand, 15651198 - 15651169
Alignment:
| Q |
137 |
cgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15651198 |
cgaggctagctgggggtggctccgcccctg |
15651169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 96; Significance: 8e-47; HSPs: 23)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 53651985 - 53651835
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
53651985 |
caaaatctgcaggaaatgcatttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacaaagaaagttg |
53651886 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53651885 |
gagctgagcctgggcactagcccaggctagctgggggtggctccgcccctg |
53651835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 44047671 - 44047520
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
44047671 |
caaaatctgcaggaaatacatttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacaaagaaagttg |
44047572 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
44047571 |
gagctgagcctgggtactagcccaggctagctggggggtggctccgcccctg |
44047520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 34 - 167
Target Start/End: Complemental strand, 44625773 - 44625633
Alignment:
| Q |
34 |
gaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctg |
127 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| |||| |||||| |||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44625773 |
gaaatgtgtttcctccagaatttacacaaaaatctgcaggaaaagctaaaaattctagtaatagttgggcttgctacaaagaaagttggagccgagcctg |
44625674 |
T |
 |
| Q |
128 |
gacactagccgaggctagctg-ggggtggctccgcccctgt |
167 |
Q |
| |
|
| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
44625673 |
ggcactagcccaggctagctggggggtggctccgcccctgt |
44625633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 37516729 - 37516567
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------------------agctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
37516729 |
caaaatctgcaggaaatgtgtttcctgcagaatttacacaaaattccgcaggtaaatccgcaggaaaagctaaaaattctagtaatggttggacttgcta |
37516630 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37516629 |
caaagaaagttggaaccgagcctgggcactagcccaggctagctgggggtggctccgcccctg |
37516567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 22 - 168
Target Start/End: Complemental strand, 28311364 - 28311211
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
28311364 |
caaaatctacaggaaatacatttcctgcggaatttacacaaaaatccgcaggaaaaactaaaaattctagtaatggtagggcttgttacaaagaaagttg |
28311265 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctgtg |
168 |
Q |
| |
|
|||| |||||||| ||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
28311264 |
gagctgagcctgggcactattccaggctagctggggggtggctccgcccctgtg |
28311211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 42 - 166
Target Start/End: Original strand, 25391878 - 25392009
Alignment:
| Q |
42 |
tttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactag |
135 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| ||||||||||||| ||| ||||||| |||||||||||||| |||||||| || ||| |
|
|
| T |
25391878 |
tttcttgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacgaagaaagttggagctgagcctgggcattag |
25391977 |
T |
 |
| Q |
136 |
ccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||| |
|
|
| T |
25391978 |
cccaggctagctggggggtggctccgcccctg |
25392009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 26371055 - 26371218
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
26371055 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggtaaatccgcagaaaatgctaaaatttctagtaatggttggatttgcta |
26371154 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||| |||||||||||||||||| | |||||||| ||||||| | |||||||||||| |||||| |
|
|
| T |
26371155 |
aaaataaagttggagccgagcctaggcactagcccaggctagttggggggtggctccacccctg |
26371218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 71 - 161
Target Start/End: Original strand, 43700243 - 43700333
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgc |
161 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||| | |||||| |||||||||||||||| |
|
|
| T |
43700243 |
agctaaaaattctagtaatggttgggcttgctacaaagaaagttggagccgagcctgagcactagtccaggctaactgggggtggctccgc |
43700333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 53987951 - 53987799
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||| | | ||||||||||| ||| |
|
|
| T |
53987951 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaaatccgcaggaaaagctaaaagttctagtaatggttgagctgactacaaagaaaattg |
53987852 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctg-ggggtggctccgcccctgt |
167 |
Q |
| |
|
||| |||||||||| ||| | |||||||| ||||||||||||||||||| |
|
|
| T |
53987851 |
aagctgagcctggactagtgcccaagctagctgaggggtggctccgcccctgt |
53987799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 22 - 167
Target Start/End: Complemental strand, 9600437 - 9600286
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||| ||| |||| |||||||||||| |||| || ||||||||||| | | |
|
|
| T |
9600437 |
caaaatctgcaggaaatgtgtttcctgcagaatttacataaaaatccgcaggaaaagccaaaagttctagtaatggctgggattactacaaagaaaatag |
9600338 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctgt |
167 |
Q |
| |
|
|||| |||| ||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
9600337 |
gagctgagcttgggctagtgcccaggctagctgggggtggctccgcccctgt |
9600286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 22 - 126
Target Start/End: Original strand, 33179158 - 33179268
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
33179158 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaattcgcaggaaaagctaaaagttctagtaatggctggacttgctacaaaaaaagttg |
33179257 |
T |
 |
| Q |
116 |
gagccgagcct |
126 |
Q |
| |
|
|||| |||||| |
|
|
| T |
33179258 |
gagctgagcct |
33179268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 42 - 166
Target Start/End: Complemental strand, 12909887 - 12909763
Alignment:
| Q |
42 |
tttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactag |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||| |||||||||||||||||||||| ||||||| | |
|
|
| T |
12909887 |
tttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacaaagaaagttggagctgagcctg-------g |
12909795 |
T |
 |
| Q |
136 |
ccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||| |
|
|
| T |
12909794 |
cccaggctagctggggggtggctccgcccctg |
12909763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 22 - 119
Target Start/End: Complemental strand, 53068329 - 53068226
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||| |||||||||||| ||| ||| |||||||||||||| |
|
|
| T |
53068329 |
caaaatctgcaggaaatgtgtttcctgtggaatttacacaaaaatccgcaggaaaagttaaaacttctagtaatggctggacttgttacaaagaaagttg |
53068230 |
T |
 |
| Q |
116 |
gagc |
119 |
Q |
| |
|
|||| |
|
|
| T |
53068229 |
gagc |
53068226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 22 - 164
Target Start/End: Complemental strand, 14461152 - 14461007
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagc------taaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |||||||||||| ||||| ||||||||||||| ||| |||||||||||||| ||| |
|
|
| T |
14461152 |
caaaatctgcaggacatacatttcctgcggaatttacataaaaatccgcaggaaaagttaaaaattctagtaatggtagggcttgctacaaagaaaattg |
14461053 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccc |
164 |
Q |
| |
|
|||| |||||||| | |||| ||||| |||||||| ||||||||||| |
|
|
| T |
14461052 |
gagctgagcctgggc---agcccaggctcgctgggggaggctccgcccc |
14461007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 22 - 128
Target Start/End: Complemental strand, 7501043 - 7500919
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------------------agctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
7501043 |
caaaatctgtaggaaatgtgtttcctgcggaatttacacaaacatccgcatgtaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgcta |
7500944 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctgg |
128 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7500943 |
caaagaaagttggagccgagcctgg |
7500919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 22 - 66
Target Start/End: Complemental strand, 35077311 - 35077267
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaat |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35077311 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaaat |
35077267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 26278450 - 26278403
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
26278450 |
caaaatctgcaggaaatgtgtttcctccggaatttacataaaaatccg |
26278403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 22 - 71
Target Start/End: Original strand, 41218405 - 41218454
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgca |
71 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
41218405 |
caaaatcggcaggaaatgtgtttcctgcggaatttagacaaaaatgcgca |
41218454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 41218472 - 41218568
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||| |||||| ||||| |||||||| | || ||||||||| ||||||||||||||||||| |
|
|
| T |
41218472 |
agctaaaagttctagtaatggctgggcttgctacaaggaaagtcggagctgagcctgggctagtgctcaggctagctggggggtggctccgcccctg |
41218568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 80 - 160
Target Start/End: Original strand, 41358725 - 41358805
Alignment:
| Q |
80 |
ttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccg |
160 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| | ||| ||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
41358725 |
ttctaataatggttgagtttgctacaaagaaagtagaagctgagtctggactagcgcccaggctagctgggggtggctccg |
41358805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 71 - 166
Target Start/End: Complemental strand, 26278383 - 26278289
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||||||||||| | || ||||| |||||||| ||||||| |||||||| | ||| ||||||||| |||||||||||||||||| |
|
|
| T |
26278383 |
agctaaaaattctagtaatggctaggcttgctccaaagaaaattggagctgagcctgggctagtgcccaggctagct-ggggtggctccgcccctg |
26278289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 22 - 68
Target Start/End: Complemental strand, 38239540 - 38239494
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatcc |
68 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
38239540 |
caaaatccgcagaaaatgtgtttcctgcagaatttacactaaaatcc |
38239494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 47511678 - 47511728
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||||| |||||||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
47511678 |
caaaatccgcaggaaatgtgtttccttcaaaatttatacaaaaatccgcag |
47511728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 93; Significance: 5e-45; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 1781056 - 1781207
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1781056 |
caaaatctgcaggaaatgtgtttcctgaggaatttacacaaaaatccacaggaaaagctaaaatttatagtaatggttgggtttgctacaaagaaagttg |
1781155 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||||||| ||||| |||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
1781156 |
gagccgaacctgggcactagcccagactagctggggggtggctccgcccctg |
1781207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 10397826 - 10397977
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10397826 |
caaaatatgcaggaaatgtgtttcctgcggaatttacacaacaatccgcaggaaaagctaaaaattctcgtaatggttgggtttgctacaaagaaagttg |
10397925 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
10397926 |
gagctgagcctgggcactagcccaggctagctggggggtggctccgcccctg |
10397977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 23663793 - 23663944
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||| |||||||||| |||||||||||||||||| |
|
|
| T |
23663793 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcaggaaaagctaaaaattatagcaatggttgggcttgctacaaagaaagttg |
23663892 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
23663893 |
gagccgagcctgggcactagcccaggctagctggggggtggctcctcccctg |
23663944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 22 - 163
Target Start/End: Original strand, 34249047 - 34249195
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34249047 |
caaaatctgcaggaaatgtgtttcctgcagaatttacacaaaaatccgcaggaaaagctaaaaattctagtaatggttgggcttgctacaaagaaagttg |
34249146 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagct-gggggtggctccgccc |
163 |
Q |
| |
|
||| ||| |||| |||||||| | ||||||| |||||||||||||||| |
|
|
| T |
34249147 |
gagttgagtctgggcactagcccaagctagctggggggtggctccgccc |
34249195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 9696137 - 9695975
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggtttgcta |
103 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||| ||||| ||||| ||||| |||||| |
|
|
| T |
9696137 |
caaaatctgcaggaaatatgtttcctgcggaatttacacaaaaatctgcaggtaaatccgcaggaaaatctaaaaattctaataatgattgggcttgcta |
9696038 |
T |
 |
| Q |
104 |
caaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
9696037 |
caaagaaagttggagccgagcctgggcactagcccaggctagctgggggtgactccgcccctg |
9695975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 9046945 - 9047111
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatc------------cgcag------ctaaaatttctagtaatggttgggttt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||| |||||||||||||||| || |
|
|
| T |
9046945 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatctacacaaaaatctacaggtaaatccgcaggaaaagctaaaaattctagtaatggttggactt |
9047044 |
T |
 |
| Q |
100 |
gctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9047045 |
actacaaagaaagttgaagctgagtctggacactagcccaggctagctgggggtggctccgcccctg |
9047111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 22 - 127
Target Start/End: Original strand, 14938944 - 14939055
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| || | |||||| |||||||||||| | ||||||||||||||||| ||| |
|
|
| T |
14938944 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaaatcagcataaaaaactaaaagttctagtaatggctaggtttgctacaaagaaaattg |
14939043 |
T |
 |
| Q |
116 |
gagccgagcctg |
127 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
14939044 |
gagctgagcctg |
14939055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 23 - 119
Target Start/End: Complemental strand, 339416 - 339314
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttgg |
116 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||| | |||||||| || ||||||||| || ||||||||||||||||||| | |
|
|
| T |
339416 |
aaaatctgcaggaaatgtatttcctacggaatttacacaaaaatccacaggaaaagctaaaagttttagtaatggctgagtttgctacaaagaaagttag |
339317 |
T |
 |
| Q |
117 |
agc |
119 |
Q |
| |
|
||| |
|
|
| T |
339316 |
agc |
339314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 2836230 - 2836399
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------------------agctaaaatttctagtaatggttgggttt |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
2836230 |
ttgacaaaatctgcaggaaatgtatttcctgcggaatttacacgaaaatccgcagatcaatccgcagaaaaagctaaaagttctaggaatggttgggttt |
2836329 |
T |
 |
| Q |
100 |
gctacaaagaaagttggagccgagcctggac-actagccgaggctagctgggggtggctccgcccctgtgt |
169 |
Q |
| |
|
|||||||||||||||||||| | |||| || | | |||| | ||||||||||||||||||||||||||| |
|
|
| T |
2836330 |
gctacaaagaaagttggagctaaacctgaactagtgcccga-gttagctgggggtggctccgcccctgtgt |
2836399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 2941304 - 2941249
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
2941304 |
caaaatctgcaggaaatgtgtttcctgcgaaatttacactaaaatccgcaggtaaa |
2941249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 15122125 - 15122070
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| |||||||||| |||| |
|
|
| T |
15122125 |
caaaatctgcaggaaatgtgtttcctgcagaatttagacacaaatccgcaggtaaa |
15122070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 30 - 128
Target Start/End: Complemental strand, 2960758 - 2960654
Alignment:
| Q |
30 |
gcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgag |
123 |
Q |
| |
|
||||||||||||||| ||||| |||||||| || ||||||||| |||||| |||||||| ||| ||| |||||||||||||| ||||||| ||| |
|
|
| T |
2960758 |
gcaggaaatgtgttttctgcgaaatttacataataatccgcaggaaaagctaaaagttctagtattggctggacttgctacaaagaaaattggagctgag |
2960659 |
T |
 |
| Q |
124 |
cctgg |
128 |
Q |
| |
|
||||| |
|
|
| T |
2960658 |
cctgg |
2960654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 15529028 - 15528973
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
15529028 |
caaaatctgcaggaaatacatttcctgcggaatttacacaaacatccgcaggtaaa |
15528973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 34188808 - 34188721
Alignment:
| Q |
80 |
ttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctggg-ggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||| |||||| | | ||| |||||||||||| |||| ||||||||||| |
|
|
| T |
34188808 |
ttctagtaatggctgggcttgctacaaagaaagttggagctgagcctcggctagtgcccaggctagctgggaggtgactccgcccctg |
34188721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 71 - 118
Target Start/End: Complemental strand, 15528961 - 15528914
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggag |
118 |
Q |
| |
|
|||||||| ||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
15528961 |
agctaaaaattctaataatggtagggcttgctacaaagaaagttggag |
15528914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 80 - 166
Target Start/End: Complemental strand, 5582493 - 5582407
Alignment:
| Q |
80 |
ttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||||| | || | |||||||||||||||| | || |||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
5582493 |
ttctagtaatagctgtgcttgctacaaagaaagtagaagttgagcctgggctagtgcccaggctagctgggggtggctccgcccctg |
5582407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 88; Significance: 5e-42; HSPs: 26)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 18 - 166
Target Start/End: Original strand, 26722968 - 26723134
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------------------ctaaaatttctagtaatggttgggttt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
26722968 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacataaaaatccgcaggtaaatccgtaggaaaagctaaaatttctagtaatggttggattt |
26723067 |
T |
 |
| Q |
100 |
gctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26723068 |
gctacaaaaaaagttggagccgagcctggaaactagcccaggctagctgggggtggctccgcccctg |
26723134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 35300529 - 35300625
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||||||||||||||||| |||||||| |||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
35300529 |
agctaaacattctagtaatggtagggcttgctacaaagaaagttggagctgagcctgggcactagcccaggctagctggggggtggctccgcccctg |
35300625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 21932809 - 21932924
Alignment:
| Q |
18 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||| || ||||| || |||||||||||||| |||||||||||||| |
|
|
| T |
21932809 |
ttgacaaaatctgcaggaaatgtgtttcctgcggaatttacacaaatat-cgcaggaaaagttaaaagttttagtaatggttgggcttgctacaaagaaa |
21932907 |
T |
 |
| Q |
112 |
gttggagccgagcctgg |
128 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
21932908 |
gttggagttgagcctgg |
21932924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 71 - 166
Target Start/End: Original strand, 41759709 - 41759804
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||||||||||| |||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
41759709 |
agctaaaagttctagtaatggctgggcttgctacaaagaaagttggagctgagcctgggctagtgcccaggctagctgggggtggctccgcccctg |
41759804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 22 - 128
Target Start/End: Original strand, 815019 - 815131
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||||| || |||||| |||||||||||| | | ||||||||||||||||||| |
|
|
| T |
815019 |
caaaatctgcaagaaatgtattttctgcggaatttacacaaaaatccgtaggaaaagctaaaagttctagtaatggctagatttgctacaaagaaagttg |
815118 |
T |
 |
| Q |
116 |
gagccgagcctgg |
128 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
815119 |
gagctgagcctgg |
815131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 28694074 - 28694129
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28694074 |
caaaatctgcaggaaatgtgtttcctgcagaatttacacaaaaatccgcagctaaa |
28694129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 21688196 - 21688146
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21688196 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
21688146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 30852424 - 30852275
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgc------agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| ||||| || ||||| |||||||||||| || | || ||||||||||| ||| |
|
|
| T |
30852424 |
caaaatctgaaggaaatgtgtttcctgcggaatttacataaaattccgcaggaaaagttaaaagttctagtaatggctgagcttactacaaagaaaattg |
30852325 |
T |
 |
| Q |
116 |
gagccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
|||| |||||||| | ||| ||||||||| |||||||||| ||||||| |
|
|
| T |
30852324 |
gagctgagcctgggctagtgcccaggctagct-ggggtggctctgcccctg |
30852275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 22 - 166
Target Start/End: Original strand, 5991442 - 5991602
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaa---------aatccgcag------ctaaaatttctagtaatggttgggtttgctacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||| |||||||||||| |||| ||||||||| |
|
|
| T |
5991442 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaccgcaggtaaatccgcaggaaaaactaaaagttctagtaatggctgggcttgctacaa |
5991541 |
T |
 |
| Q |
107 |
agaaagttggagccgagcctggacactagccgaggctagct-gggggtggctccgcccctg |
166 |
Q |
| |
|
||||| |||||| |||||||| | ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
5991542 |
agaaaattggagttgagcctgggctagtgcccaggctagctggggggtggctccgcccctg |
5991602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 7873242 - 7873297
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
7873242 |
caaaatctgcaggaaatgtgtttcctgcggaatttacataaaaacccgcaggtaaa |
7873297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 22 - 118
Target Start/End: Original strand, 42439608 - 42439710
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||| || |||| |||||| |||||||||||| || | ||||||||||||||||| |
|
|
| T |
42439608 |
caaaatctgcagaaaatgtgtttcctgcgaaatttacacaaaactctgcaggtaaaactaaaagttctagtaatggctgagcatgctacaaagaaagttg |
42439707 |
T |
 |
| Q |
116 |
gag |
118 |
Q |
| |
|
||| |
|
|
| T |
42439708 |
gag |
42439710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 22 - 68
Target Start/End: Original strand, 41759642 - 41759688
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatcc |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41759642 |
caaaatctgcaggaaatgtgtttcctgcggaatttacaccaaaatcc |
41759688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 22 - 78
Target Start/End: Original strand, 38129027 - 38129083
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaaa |
78 |
Q |
| |
|
|||||| ||||||||||||||||||| | |||||||||||||||||||||| ||||| |
|
|
| T |
38129027 |
caaaatatgcaggaaatgtgtttccttcagaatttacacaaaaatccgcaggtaaaa |
38129083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 3012391 - 3012336
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||||| |||| |||| |
|
|
| T |
3012391 |
caaaatctgcaggaagtgtgtttcctgcggaatgtacacaaaaatcggcaggtaaa |
3012336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 23704503 - 23704558
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||| ||| |||| |
|
|
| T |
23704503 |
caaaatctgcaggaaatgtgttttcggcggaatttacacaaaaatccacaggtaaa |
23704558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 35300462 - 35300512
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35300462 |
caaaatctgcaggaaatacatttcctgcggaatttacacaaaaatccgcag |
35300512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 22 - 72
Target Start/End: Original strand, 38991194 - 38991244
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag |
72 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38991194 |
caaaatctgcaggaaatgtgtttccaacggaatttatacaaaaatccgcag |
38991244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 3012324 - 3012280
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3012324 |
agctaaaagttctagtaatggttgggcttgctacaaagaaagttg |
3012280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 119
Target Start/End: Original strand, 7873309 - 7873357
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagc |
119 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7873309 |
agctaaaagttctagtaatggttgggcttgctacaaagaaaattggagc |
7873357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 23 - 59
Target Start/End: Original strand, 22206709 - 22206745
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttaca |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22206709 |
aaaatctgcaggaaatgtgtttcctgcggaatttaca |
22206745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 23 - 59
Target Start/End: Complemental strand, 22228030 - 22227994
Alignment:
| Q |
23 |
aaaatctgcaggaaatgtgtttcctgcggaatttaca |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22228030 |
aaaatctgcaggaaatgtgtttcctgcggaatttaca |
22227994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 19377476 - 19377421
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| |||||| |||||||| |||| |
|
|
| T |
19377476 |
caaaatctgcaggaaatgtatttccttcggaatttccacaaacatccgcaggtaaa |
19377421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 71 - 163
Target Start/End: Original strand, 22206775 - 22206868
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctggg-ggtggctccgccc |
163 |
Q |
| |
|
|||||||| || |||||||| |||| |||||||||||||| ||||||| |||||||| | ||| |||||||||||| ||||||||||||| |
|
|
| T |
22206775 |
agctaaaaattatagtaatgcctgggcttgctacaaagaaaattggagctgagcctgggctagtgcccaggctagctgggtggtggctccgccc |
22206868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 71 - 163
Target Start/End: Complemental strand, 22227964 - 22227871
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggacactagccgaggctagctggg-ggtggctccgccc |
163 |
Q |
| |
|
|||||||| || |||||||| |||| |||||||||||||| ||||||| |||||||| | ||| |||||||||||| ||||||||||||| |
|
|
| T |
22227964 |
agctaaaaattatagtaatgcctgggcttgctacaaagaaaattggagctgagcctgggctagtgcccaggctagctgggtggtggctccgccc |
22227871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 25688212 - 25688249
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttaca |
59 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25688212 |
caaaatctgcaggaaatatgtttcctgcggaatttaca |
25688249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 22 - 69
Target Start/End: Complemental strand, 4843385 - 4843338
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg |
69 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
4843385 |
caaaatctgcatgaaatgtgtttcatgcggaatgtacacaaatatccg |
4843338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075 (Bit Score: 78; Significance: 5e-36; HSPs: 2)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 22 - 166
Target Start/End: Complemental strand, 11605 - 11456
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa-----atttctagtaatggttgggtttgctacaaagaaagttgg |
116 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| ||||||||| ||| | ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11605 |
caaaatctgcaggaaatgcattttctgcggaatttacacaataatccgcaggaaaagaaaaaattctagtaatggtagggcttgctacaaagaaagttgg |
11506 |
T |
 |
| Q |
117 |
agccgagcctggacactagccgaggctagctgggggtggctccgcccctg |
166 |
Q |
| |
|
||| |||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
11505 |
agctgagcctgggcactagtccaggctagctgggggtggctccgcccctg |
11456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 22 - 119
Target Start/End: Complemental strand, 6992 - 6889
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcag------ctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| ||||||||| |||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
6992 |
caaaatctgcaggaaatgcatttccttcggaatttacacaataatccgcaggaaaagctaaaaattctagtaatggtagggcttgctacaaagaaagttg |
6893 |
T |
 |
| Q |
116 |
gagc |
119 |
Q |
| |
|
|||| |
|
|
| T |
6892 |
gagc |
6889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0618 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0618
Description:
Target: scaffold0618; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 22 - 125
Target Start/End: Complemental strand, 1777 - 1668
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccg------cagctaaaatttctagtaatggttgggtttgctacaaagaaagttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| || ||||| || || ||||| ||||| || ||||||||||||||| |
|
|
| T |
1777 |
caaaatctgcaggaaatgtgtttcctgcgaaatttacacaaaaatccgaaggaaaaggtaaaaattttaataatgattgggctttctacaaagaaagttg |
1678 |
T |
 |
| Q |
116 |
gagccgagcc |
125 |
Q |
| |
|
|||| ||||| |
|
|
| T |
1677 |
gagctgagcc |
1668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0638 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0638
Description:
Target: scaffold0638; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 77
Target Start/End: Complemental strand, 4192 - 4137
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||| |||||||| |||| |
|
|
| T |
4192 |
caaaatctgcaggaaatgtgtttcctacggaatttacataaacatccgcaggtaaa |
4137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0638; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 71 - 128
Target Start/End: Complemental strand, 4125 - 4068
Alignment:
| Q |
71 |
agctaaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctgg |
128 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
4125 |
agctaaaagttctagtaatggctgggcttgctacaaagaaaattggagctgagcctgg |
4068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 109333 - 109388
Alignment:
| Q |
22 |
caaaatctgcaggaaatgtgtttcctgcggaatttacacaaaaatccgcagctaaa |
77 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
109333 |
caaaatctgcagaacatgtgttttctgcggaatttacacaaaaattcgcaggtaaa |
109388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 74 - 130
Target Start/End: Original strand, 109403 - 109459
Alignment:
| Q |
74 |
taaaatttctagtaatggttgggtttgctacaaagaaagttggagccgagcctggac |
130 |
Q |
| |
|
||||| |||||||||| |||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
109403 |
taaaagttctagtaataactggggttgctacaaagaaagttggagctgagcctggac |
109459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University