View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17544_high_22 (Length: 322)
Name: NF17544_high_22
Description: NF17544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17544_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 25 - 283
Target Start/End: Complemental strand, 42138600 - 42138343
Alignment:
| Q |
25 |
tcatcaaaggtgctatttctgacaatcaatgtctggggcgttgcctctatattcacggtgttccgggcactggcaaggtactatcttctagaactagcta |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42138600 |
tcatcaaaggtgctatttctgacaatcaatgtctggggcgttgcctctatattcacggtgttccgggcactggcaaggtactatcttctagaactagcta |
42138501 |
T |
|
| Q |
125 |
cattgctcgttggtctaatatgcagcagaactttagtttagatatcacgaagcaattcttattttattactccttttttatgtgtgtaactgcagacaat |
224 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42138500 |
cattgcttgttggtcta-tatgcagcagaactttagtttagatatcacgaagcaattcttattttattactccttttttatgtgtgtaactgcagacaat |
42138402 |
T |
|
| Q |
225 |
gagtgtactctcagtgatgaggagtttgaagtcagaagttgatgcaggaaacatcaaac |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42138401 |
gagtgtactctcagtgatgaggagtttgaagtcagaagttgatgcaggaaacatcaaac |
42138343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University