View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17544_low_2 (Length: 255)
Name: NF17544_low_2
Description: NF17544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17544_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 142 - 233
Target Start/End: Original strand, 4284502 - 4284593
Alignment:
| Q |
142 |
caagatcaaataatgaagaaaaggaagaactttcagaagtcataaaatatggtatgactcgtgcgcccaagcacacgacccgttcgtggatc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
4284502 |
caagatcaaataatgaagaaaaggaagaactttcagaagtcagaaaatatggtatgactcgtgcgcccaagcacacgacccatgcgtggatc |
4284593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 23 - 90
Target Start/End: Original strand, 4284383 - 4284450
Alignment:
| Q |
23 |
tgtcatctgctatgataagtcctaatttatagtgtttttagtctttgaattaaataaaatttgtggga |
90 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284383 |
tgtcatctgctctgataagtcctaatttatagtgtttttagtctttgaattaaataaaatttgtggga |
4284450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 34 - 90
Target Start/End: Original strand, 10234324 - 10234380
Alignment:
| Q |
34 |
atgataagtcctaatttatagtgtttttagtctttgaattaaataaaatttgtggga |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10234324 |
atgataagtcctaatttatagtgtttttagtctttgagttaaataaaatttgtggga |
10234380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 37 - 84
Target Start/End: Original strand, 28973359 - 28973406
Alignment:
| Q |
37 |
ataagtcctaatttatagtgtttttagtctttgaattaaataaaattt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28973359 |
ataagtcctaatttatagtgtttttagtctttgaattaagtaaaattt |
28973406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University