View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17545_high_5 (Length: 283)
Name: NF17545_high_5
Description: NF17545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17545_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 34 - 283
Target Start/End: Original strand, 27125200 - 27125446
Alignment:
| Q |
34 |
aaaatattaggttgaaaataagaggtagaatgtgccaattgtatatgaatcggctgaacctattcaggtcctaccgattcaatactcgattggtattgat |
133 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||| ||||| |
|
|
| T |
27125200 |
aaaatattaggttgaaaataggaggtagaatgtgccaattgtatatgaatcagctgaacctattgaggtc--accgattcaatactcgattggtcttgat |
27125297 |
T |
 |
| Q |
134 |
taacaatatctacctaatttgtggttccttgcacaccttgttggtgaccgaattgtcaccaaaatcagttgaagctttgtgatcctacacagttacaact |
233 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
27125298 |
taacaatgtctacataatttgtggttccttgtacaccttgttggtgaatgaattgtcaccaaaatcagttgaagc-ttgtgatactacacagttacaact |
27125396 |
T |
 |
| Q |
234 |
atggtggtcctacacagtttgaggtttattattctgagagctttattatc |
283 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
27125397 |
atggtggtcctacacagtttgatgtttattattctgaaagctttattatc |
27125446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University