View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17545_low_10 (Length: 251)
Name: NF17545_low_10
Description: NF17545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17545_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 54044474 - 54044269
Alignment:
| Q |
1 |
tttagcacgacatacttcttctctgacaggtaggggtgaaaatacccaacaagacggcagcaaatactcgcattttttgccctttatgtctcagtcttcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54044474 |
tttagcacgacatacttcttctctgacaggtaggggtgaaagtacccaacaagacggcagcaaatactggcattttttgccctttatgtctcagtcttcc |
54044375 |
T |
 |
| Q |
101 |
atcctgcttaatatgagtagtatttttaattcttgcatatatcatatatgctttgcttaattctgaatcaaacccttcgattataatttgaagtcttctc |
200 |
Q |
| |
|
|| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54044374 |
----tgtttaatat----agtatttctaattcttgcatatatcatatatgctttgcttaattctgaatcaaacccttcgattataatttgaagtcttctc |
54044283 |
T |
 |
| Q |
201 |
ttctgtgaaataac |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
54044282 |
ttctgtgaaataac |
54044269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University