View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17545_low_11 (Length: 244)
Name: NF17545_low_11
Description: NF17545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17545_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 42438792 - 42438833
Alignment:
| Q |
5 |
ctcgaagacgccgtcaatgccgccgttagagccaaaacctcc |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42438792 |
ctcgaagacgccgtcaatgccgccgttagagccaaaacctcc |
42438833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 94
Target Start/End: Complemental strand, 42567249 - 42567217
Alignment:
| Q |
62 |
ttctcaatgcagagtttattatagttttgagtt |
94 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
42567249 |
ttctcaatgcatagtttattatagttttgagtt |
42567217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University