View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17545_low_11 (Length: 244)

Name: NF17545_low_11
Description: NF17545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17545_low_11
NF17545_low_11
[»] chr5 (2 HSPs)
chr5 (5-46)||(42438792-42438833)
chr5 (62-94)||(42567217-42567249)


Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 42438792 - 42438833
Alignment:
5 ctcgaagacgccgtcaatgccgccgttagagccaaaacctcc 46  Q
    ||||||||||||||||||||||||||||||||||||||||||    
42438792 ctcgaagacgccgtcaatgccgccgttagagccaaaacctcc 42438833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 94
Target Start/End: Complemental strand, 42567249 - 42567217
Alignment:
62 ttctcaatgcagagtttattatagttttgagtt 94  Q
    ||||||||||| |||||||||||||||||||||    
42567249 ttctcaatgcatagtttattatagttttgagtt 42567217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University