View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17545_low_7 (Length: 295)
Name: NF17545_low_7
Description: NF17545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17545_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 118 - 255
Target Start/End: Original strand, 40224771 - 40224908
Alignment:
| Q |
118 |
cctgaatcagtaatctcactctcaggggaatcatactcctcgtgttcatcaccaccaccgtcgatcactttctcctctgttttctgttcctcctcttcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224771 |
cctgaatcagtaatctcactctcaggggaatcatactcctcgtgttcatcaccaccaccgtcgatcactttctcctctgttttctgttcctcctcttcca |
40224870 |
T |
|
| Q |
218 |
tcacaacgatgtcgttttgaataacctcctcaacggta |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40224871 |
tcacaacgatgtcgttttgaataacctcctcaacggta |
40224908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 40224654 - 40224687
Alignment:
| Q |
1 |
caaagaaagaacagagagattcagctatgaatgt |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40224654 |
caaagaaagaacagagagattcagctatgaatgt |
40224687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University