View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17546_high_9 (Length: 294)
Name: NF17546_high_9
Description: NF17546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17546_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 14 - 277
Target Start/End: Complemental strand, 17122455 - 17122198
Alignment:
| Q |
14 |
gaagtactaagaaagagtacctttttatagttttagtgtccctcaaggatgattcacttcacatggaggtgatgcaaacgggtatggcaccgtcgtgttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17122455 |
gaagtactaagaaagagtacctttttatagttttagtgtccctcaaggatgattcacttcacatggaggtgatgcaaacgggtatggcaccgtagtgttg |
17122356 |
T |
|
| Q |
114 |
ccgcatataggctgcggcaacatggagatttctcaaattgggaagaataatttgttgcaagaaggtacaccatgttataatgagaaacaatgaatctaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17122355 |
ccgcatataggctgcggcaacatggagatttctcaaattgggaagaataatttgttgcaagaaggtacaccatgttataatgagaaacaatgaatctaga |
17122256 |
T |
|
| Q |
214 |
ggttaataagcccttgctaattgcttacatttaactttctttttcgtgcgggggattacatttt |
277 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17122255 |
ggttaat------ttgctaattgcttacatttaactttcttttttgtgcgggggattacatttt |
17122198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University