View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17546_low_21 (Length: 215)
Name: NF17546_low_21
Description: NF17546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17546_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 48 - 192
Target Start/End: Complemental strand, 4265014 - 4264863
Alignment:
| Q |
48 |
aacatttgcattgttaaaaagattagaactagaaattttaaatatagcagtgagccacttgtttggtttttattctaacatgtgaaaaaacaatactatt |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
4265014 |
aacatttgcattgttaaaaagattagaactagaaattttaaatatagcagtgagccacttgtttggtttttattctagcatgtgaaaaaataatactatt |
4264915 |
T |
|
| Q |
148 |
aaaacttgaaattagtaacgg-------tttgggagctgtatgactagtatt |
192 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4264914 |
aaaacttgaaattagtaacggtcattaatttgggagctgtatgactagtatt |
4264863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 120 - 166
Target Start/End: Complemental strand, 4294723 - 4294677
Alignment:
| Q |
120 |
ttctaacatgtgaaaaaacaatactattaaaacttgaaattagtaac |
166 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4294723 |
ttctaacatatgaaaaaataatactattaaaacttgaaataagtaac |
4294677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 4265070 - 4265042
Alignment:
| Q |
15 |
agcagagacttgaaaacacaaacgtaaac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4265070 |
agcagagacttgaaaacacaaacgtaaac |
4265042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University