View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17546_low_7 (Length: 408)
Name: NF17546_low_7
Description: NF17546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17546_low_7 |
 | |
|
| [»] scaffold0160 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0160 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 8 - 284
Target Start/End: Complemental strand, 18263 - 17987
Alignment:
| Q |
8 |
ccaataaaattagaaatcatattgaaaagttgaaagttgagttcctagatgacattgctatattatttctttccataataataaagtaggatacttgcta |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18263 |
ccaacaaaattagaaatcatattgaaaagttgaaagttgagttcctagatgacattgctatattatttctttccataataataaagtaggatacttgcta |
18164 |
T |
|
| Q |
108 |
cttgctaggactcattgaatttctttgagtggtgacaatttcatgcttttaatttaccacttcttttacatactttctttatacgccactaaactatacc |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18163 |
cttgctgggactcattgaatttctttgagtggtgactatttcatgcttttaatttaccacttcttttacatactttctttatacgccactaaactatacc |
18064 |
T |
|
| Q |
208 |
tcatttgaatctttctgctcagtgacttggtttctatgttccatttcgtcaagtttccatcatgattagatagattg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18063 |
tcatttgaatctttctgctcagtgacttggtttctatgttccatttcgtcaagtttccatcatgattagatagattg |
17987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 334 - 390
Target Start/End: Complemental strand, 17937 - 17881
Alignment:
| Q |
334 |
gtaagaaactcttcttggttgatttcatctctaactcattaataagaaacatacgta |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17937 |
gtaagaaactcttcttggttgatttcatctctaacacattaataagaaacatacgta |
17881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University