View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17547_low_2 (Length: 400)
Name: NF17547_low_2
Description: NF17547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17547_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 79 - 381
Target Start/End: Complemental strand, 32012615 - 32012316
Alignment:
| Q |
79 |
ataacaataataattatagggatgattttattggacctggatcaccaagttttagagaatattgtactgattatgattctgtggatagaaattctatggt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32012615 |
ataacaataataattatagggatgattttattggacctggatcaccaagttttagagaatattgtactgattatgattctgtggatagaagttctatggt |
32012516 |
T |
 |
| Q |
179 |
agattctaatgattatactgaatctgaagaaagcatgaagaatagtagtagtgagtaatatggcttttgtcatgtgnnnnnnnnaaattatattttcatc |
278 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
32012515 |
agattctaatgattatactgaatctggagaaagcatgaagaatagtagtagtgag---tatggcttttgtcatgtgtttttttttaattatattttcatc |
32012419 |
T |
 |
| Q |
279 |
aactgtttaatttgatatgattaactatgttagtttgtttaggttatgattcctaaactttattggtgataattgttaattagatattgatttatataac |
378 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32012418 |
aactgtttaatttcatatgattaattatgttagtttgtttaggttaagattcctaaactttattggtgataattgttaattagatattgatttatataac |
32012319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University