View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17547_low_3 (Length: 360)
Name: NF17547_low_3
Description: NF17547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17547_low_3 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 9 - 339
Target Start/End: Complemental strand, 41980 - 41650
Alignment:
| Q |
9 |
tgtccaagaatatcgtgatagcaataccctgaatttgaccgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtg |
108 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980 |
tgtccaacaaaatcgtgatagcaataccctgaatttgactgtggaaccgcatggtgcctttacgagcagaaccgttcaaggcattcagtgacaagtggtg |
41881 |
T |
 |
| Q |
109 |
ctcctccgtaacaataggtggtgtttcagggtcagttgatggtgtgatttgcggtggtggtgggtcaggttcttcttcttctttagtttgaaataagaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
41880 |
ctcctccgtaacaataggtggtgtttcagggtcagctgatggtgtgatttgttgtggtggtggttcaggttcttcttcttcttcagtttggaataagaaa |
41781 |
T |
 |
| Q |
209 |
taatgacgatttggacatttatgagatatagagaatcgttcatcacaataataacataatcctttttctcttctcagcatcatctcagatctagtgatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
41780 |
taatgacgatttggacatttatgagatatagagaatcgttcatcacaataatagcataatcctttttctcttctgagcatcatctcagctctagtgatgt |
41681 |
T |
 |
| Q |
309 |
ttttaactgggtggccttttgtgggtaggtt |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41680 |
ttttaactgggtggccttttgtgggtaggtt |
41650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 282
Target Start/End: Complemental strand, 8596080 - 8596019
Alignment:
| Q |
221 |
ggacatttatgagatatagagaatcgttcatcacaataataacataatcctttttctcttct |
282 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
8596080 |
ggacatttatgagaaaatgagaatttctcatcacaaaaataacataaacctttttctcttct |
8596019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University