View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17547_low_5 (Length: 224)
Name: NF17547_low_5
Description: NF17547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17547_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 209
Target Start/End: Original strand, 29488082 - 29488271
Alignment:
| Q |
20 |
catgcaccattggtcggacacttctaaatttccttcaaatgcgcgatgcatggtttgtagcacgcatcgtgaatttactagtagctgatccttcattttc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29488082 |
catgcaccattggtcggacacttctaaattttcttcaaatgcgcgatgcatcgtttgtagcacgcatcgtgaatttactagtagctgatccttcattttc |
29488181 |
T |
 |
| Q |
120 |
tcttcatccgttgccccattactcctcaccaaattgccctagtagctataccccaagaaataacttgatataatttgtaagaaagtataa |
209 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29488182 |
tcttcatcccttgccccattactcctcatcaaattgccctagtagctataccccaagaaataacttgatataatttgtaagaaagtataa |
29488271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University