View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17548_high_10 (Length: 243)
Name: NF17548_high_10
Description: NF17548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17548_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 44533930 - 44533872
Alignment:
| Q |
168 |
ccacatcaccctcttcaaatgtagttggaggtctccattgttgttctggctgcaccatc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44533930 |
ccacatcaccctcttcaaatgtagttggaggtctccattgttgttctggctgcaccatc |
44533872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 44534097 - 44534045
Alignment:
| Q |
1 |
cattgatgaaagtttatttgttgtcacaacttcataacggctactaacacctc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44534097 |
cattgatgaaagtttatttgttgtcacaacttcataacggctactaacacctc |
44534045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University