View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17548_high_4 (Length: 332)
Name: NF17548_high_4
Description: NF17548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17548_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 43559051 - 43559368
Alignment:
| Q |
1 |
gaatttgtaagtatatgatgaaatgtatgggtttttgtctttttgatcatatttgagtctttgaccaaagagaaaaagggtgataaatataaaatatgta |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43559051 |
gaatttgtaagtatatgatgcaatgtatgggtttttgtctttttgatcatatttgagtctttgaccaaagagaaaaagggtgataaatataaaatatgta |
43559150 |
T |
 |
| Q |
101 |
atactaat-----aattcagtagttgtagtgttggacaatataaaatattacagccacaaaacaaaattagcttcaatcattaatcttaaagaatatacc |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43559151 |
atactaatataataattcagtagttgtagtgttggacaatataaaatattacagccacaaaacaaaattagctacaatcattaatcttaaagaatatacc |
43559250 |
T |
 |
| Q |
196 |
gttattcaaactttggcttatgaaaacagatacatcaatcaatggtaaggnnnnnnnnnnnnnnntccgggggagggggtatcaaatctcaatctcaatc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43559251 |
gttattcaaactttggcttatgaaaacagatacatcaatcaatggtaaggaaaaaaaaataaaaatccgggggagggggtatcaaatctcaatctcaatc |
43559350 |
T |
 |
| Q |
296 |
ttaattttatgtactatc |
313 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
43559351 |
ttaatcatatgtactatc |
43559368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University