View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17548_high_7 (Length: 279)
Name: NF17548_high_7
Description: NF17548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17548_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 26252869 - 26252741
Alignment:
| Q |
1 |
ctccctttacacctttgtttcttcctacttacccttctaatattccttggtttttcatggtattcaaactatgaaccaatcatggaaagcataatggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26252869 |
ctccctttacacctttgtttcttcctacttacccttctaatattccttggtttttcatggtactcaaactatgaaccaatcatggaaagcataatggatc |
26252770 |
T |
 |
| Q |
101 |
aagtgaagatggttctaatgatttcacca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26252769 |
aagtgaagatggttctaatgatttcacca |
26252741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 194 - 274
Target Start/End: Complemental strand, 26252676 - 26252596
Alignment:
| Q |
194 |
tgattcctttgcctgagagagagtcacttcatagagctggtggaactccttggggtgttggtttgtttcttgttgttcttc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26252676 |
tgattcctttgcctgagagagagtcacttcatagagctggtggaactccttggggtgttggtttgtttcttgttgttcttc |
26252596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University