View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17549_low_7 (Length: 228)
Name: NF17549_low_7
Description: NF17549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17549_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 218
Target Start/End: Complemental strand, 5465316 - 5465115
Alignment:
| Q |
17 |
tgaaagtgtggattgaaaataacaacataagtttcttttggtttttggattgaaaaataacaacaataagccttgttgcaacattttaagtcagtacttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5465316 |
tgaaagtgtggattgaaaataacaacataagtttcttttggtttttggattgaaaaataacaacaataagccttgttacaacattttaagtcagtacttt |
5465217 |
T |
|
| Q |
117 |
gagtcttcagttttactttgttttgggtttacctaatagctaatttcaagaagcattgtgcgtcatcattttacactttaagtttgttagaagttttgat |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5465216 |
gagtcttcaattttactttgttttgggtttacctaatagctaatttcaagaagcattgtgtgtcatcattttacactttaagtttgttagaagttttgat |
5465117 |
T |
|
| Q |
217 |
ga |
218 |
Q |
| |
|
|| |
|
|
| T |
5465116 |
ga |
5465115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University