View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17549_low_9 (Length: 201)
Name: NF17549_low_9
Description: NF17549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17549_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 33125530 - 33125364
Alignment:
| Q |
20 |
atgttggaatcaggttctactccggattgtaagtgcctacaaactttcagttattacatgtagatgactatttgatattgcatatgcgtctcaaaatttg |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
33125530 |
atgttggaatcaggttctactcctgattgtaagtgcctacaaactttcagttattatatgtagatgactatttgacattgcatatgcttctcaaaatttg |
33125431 |
T |
 |
| Q |
120 |
atattaattagcacaaataagagaggcttagttcttaattaacatttggaagatgtagtaaaaaatc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33125430 |
atattaattagcacaaataagagaggcttagttcttaattaacatttggaagatgtagtaaaaaatc |
33125364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University