View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1755-Insertion-22 (Length: 58)
Name: NF1755-Insertion-22
Description: NF1755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1755-Insertion-22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 32511044 - 32511092
Alignment:
| Q |
8 |
attagtgaattcaataatca-agaccactccctccctactgtatcttaa |
55 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32511044 |
attagtgaattcaataatctgagaccactccctccctactgtatcttaa |
32511092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University