View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17550_high_14 (Length: 313)
Name: NF17550_high_14
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17550_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 132 - 276
Target Start/End: Original strand, 4095511 - 4095652
Alignment:
| Q |
132 |
ttttttccaaattgttcatatgtttgttggtaggcagattatatggtcaccgtgtagaagctcgcggtcctccttgtccttgtagctgggatggtgactt |
231 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095511 |
ttttttccaaattgttcatatgtttgctggtaggcagattatatggtcaccgtgtagatgctcgcggtcctccttgtccttgtagctgggatggtgact- |
4095609 |
T |
 |
| Q |
232 |
gatgatcggtaccagttcaataaaagcaaggaaaaatgaatatgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4095610 |
--tgatcggtaccagttcaataaaagcaaggaaaaatgaatatgt |
4095652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 77 - 136
Target Start/End: Original strand, 4095437 - 4095495
Alignment:
| Q |
77 |
attgaattgaattgagtattgtaaaaaagttttcttctcttgtaagatatctcaattttt |
136 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4095437 |
attgaattga-ttgagtattgtaaaaatgttttcttctcttgtaagatatctcaattttt |
4095495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University