View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17550_high_17 (Length: 283)
Name: NF17550_high_17
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17550_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 11 - 259
Target Start/End: Original strand, 43736799 - 43737048
Alignment:
| Q |
11 |
cacagacacaaaaaccaatcaaaagaaatagaattttca-cttattttgaaagaactgatgaaatagctgtgatcacttagacatgaattgagttgaagg |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43736799 |
cacaaacacaaaaaccaatcaaaagaaatagaattttcaacttattttgaaagaactgatgaaatagctgtgatcacttagacatgaattgagttgaagg |
43736898 |
T |
|
| Q |
110 |
aggattgttcaatgttggatcactttgctgttttgaatgctgcagtgcaagaattccattccaccctgcactcacattttttgttatagttgtcaatttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43736899 |
aggattgttcaatgttggatcactttgatgttttgaatgctgtagtgcaagaattccattccaccctgcactcacattttttgttatagttgtcaattta |
43736998 |
T |
|
| Q |
210 |
cagtcactttataaatgaacatctttatttataagaagaaaatgtaaaaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43736999 |
cagtcactttataaatgaacatctttatttataagaagaaaatgtaaaaa |
43737048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University