View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17550_high_23 (Length: 246)
Name: NF17550_high_23
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17550_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 8793174 - 8793389
Alignment:
| Q |
21 |
taccaaattcattaactccttaatgaatgagatatgcgacagaatcaccatgatatgaaatatgaatataatacatgtaacttattagatgaacaacttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
8793174 |
taccaaattcattaactccttaatgaatgagatatgcgacagaatcaccatgatatgaaatatgaatacaa-acatgtaacttattagatgaacaacttt |
8793272 |
T |
|
| Q |
121 |
tgacttgtgtactatctatctgtgagcatgaagtcatgcaagttgtcaaaataattgaacatatgatagatattattgatactgttttgttatccaaaat |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8793273 |
tgacttgtgtactat----ctgtgagcatgaagtcatgcaagttgtcaaaataattgaacatatgatagatattattgatactgttttgttatccaaaat |
8793368 |
T |
|
| Q |
221 |
atgagattggcctttgctact |
241 |
Q |
| |
|
|||||||||||| ||| |||| |
|
|
| T |
8793369 |
atgagattggcccttggtact |
8793389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University