View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17550_high_24 (Length: 242)

Name: NF17550_high_24
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17550_high_24
NF17550_high_24
[»] chr1 (1 HSPs)
chr1 (14-225)||(42158693-42158904)


Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 42158693 - 42158904
Alignment:
14 aagcaaaggtccacgaaaacgaaatgtatggtgaagatcttcaagtaacttaacgagtagagagcgttgattgtcaaggagatctaagattgaatggttt 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||     
42158693 aagccaaggtccacgaaaacgaaatgtatggtgaagatcttcaagtaacttaacgagtagaaagcgttgattgtcaaggagatctaagattgaatggttc 42158792  T
114 ttgagaagaagtaaaagttccgccaaggttgtgtatgccaagcccttcacttcaggagacttgaaagtaggcagagttacttcggagccatgagaagcga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
42158793 ttgagaagaagtaaaagttccgccaaggttgtgtatgccaagcccttcacttcaggagacttgaaagtaggcagagttatttcggagccatgagaagcga 42158892  T
214 tgaagtttgaaa 225  Q
    ||||||||||||    
42158893 tgaagtttgaaa 42158904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University