View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17550_low_12 (Length: 445)
Name: NF17550_low_12
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17550_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 223 - 431
Target Start/End: Original strand, 19235875 - 19236079
Alignment:
| Q |
223 |
gaaatgatcatcatactttgagtttaattcattcaatccaatcattccaaaatatttcatattgcttgccaaaatgctagcaagaaattttctctcataa |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235875 |
gaaatgatcatcatactttgagtttaattcattcaatccaatcattccaaaatctttcatattgcttgccaaaatgctagcaagaaattttctctca--- |
19235971 |
T |
|
| Q |
323 |
cagactgatttcagaaaaatcaaatttgaatacctagagtcctagacagacacaaaatggtccataagaaataacaaaaccaaaaatgacaactaataat |
422 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235972 |
-agactggtttcagaaaaatcaaatttgaatacctagagtcctagacagacacaaaatggtccataagaaataacaaaaccaaaaatgacaactaataat |
19236070 |
T |
|
| Q |
423 |
ggtaaatta |
431 |
Q |
| |
|
||||||||| |
|
|
| T |
19236071 |
ggtaaatta |
19236079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 11 - 145
Target Start/End: Original strand, 19235661 - 19235795
Alignment:
| Q |
11 |
caaaggtcattaagtgcttacagggatatataaataatctctatagccatcagcataaagtattacatcaaaatcatttagcatcatcctaatttggtaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19235661 |
caaaggtcattaagtgcttacagggatatataaataatctctatagccatcaccataaagtattacatcaaaatcatttagcatcatcctgatttggtaa |
19235760 |
T |
|
| Q |
111 |
tggaaggatgaacagcctaagggattcatgcactt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235761 |
tggaaggatgaacagcctaagggattcatgcactt |
19235795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University