View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17550_low_17 (Length: 356)
Name: NF17550_low_17
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17550_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 223 - 339
Target Start/End: Complemental strand, 32184710 - 32184594
Alignment:
| Q |
223 |
ttctattatatcactctatttttctcttcattttaaaatgtataacttttttcctaatctctgacttcatacagtacctcatatttttaatctatatttc |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
32184710 |
ttctattatatcactctatttttctcttcattttaaaatgtataacttttttcctaatctctgacttcatttagtacctcatatttttaatctctatttc |
32184611 |
T |
 |
| Q |
323 |
aatcataatattaataa |
339 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
32184610 |
aatcataatattaataa |
32184594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University