View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17550_low_35 (Length: 218)
Name: NF17550_low_35
Description: NF17550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17550_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 31688708 - 31688525
Alignment:
| Q |
16 |
aaaggggaatacttactaaaacagaaggtagaagaaaaatctaaggaaattggaatggaatcggcccgaaagcggaaagctgaagcttggctagaagctc |
115 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31688708 |
aaagaggaatacttactaaaacagaaggtagaggaaaaatctaaggaaattggaatggaatcggcccgaaagcggaaagctgaagcttggctagaagctc |
31688609 |
T |
|
| Q |
116 |
agaaggaaatgacttttgcgcggaccggagaccatgctaaagtcgctgaactcgaggaagatctgaaggagatgataaggtggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31688608 |
agaaggaaatgacttttgcgcggaccggagaccatgctaaagtcgctgaactcgaggaagatctgaaggag-tgataaggtggag |
31688525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 72 - 198
Target Start/End: Complemental strand, 31691699 - 31691573
Alignment:
| Q |
72 |
ggaatcggcccgaaagcggaaagctgaagcttggctagaagctcagaaggaaatgacttttgcgcggaccggagaccatgctaaagtcgctgaactcgag |
171 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||| ||| |||||||||||| |
|
|
| T |
31691699 |
ggaattggcccgaaagcggaaagttgaagcttggctagaagctgagaaggaaatgacttttgctataaccggagactatgctgaagatgctgaactcgag |
31691600 |
T |
|
| Q |
172 |
gaagatctgaaggagatgataaggtgg |
198 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31691599 |
aaagatctgaaggagatgataaggtgg |
31691573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University