View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17551_high_10 (Length: 232)
Name: NF17551_high_10
Description: NF17551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17551_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 11 - 197
Target Start/End: Complemental strand, 8211094 - 8210908
Alignment:
| Q |
11 |
gagagagaagaaagggataannnnnnngatactggaagaaagggataatgatcagggataacctttgtttgatgtgttgggtcttggcctattggtttag |
110 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8211094 |
gagatagaagaaagggataatttttttgatactggaagaaagggataatgatcagggataacctttgtttgatgtgttgggtcttggcctattggtttag |
8210995 |
T |
|
| Q |
111 |
tgacacatttcggtatttataaattgatgtttgttatacgtgttgattgaaaaatgaaatgaaattagtattatgagtttggttttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8210994 |
tgacacatttcggtatttataaattgatgtttgttatacgtgttgattgaaaaatgaaatgaaattagtattatgagtttggttttg |
8210908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University