View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17551_high_6 (Length: 279)
Name: NF17551_high_6
Description: NF17551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17551_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 3660093 - 3660274
Alignment:
| Q |
8 |
catcatcatcaccttctggttttcttggtctccgaactttctgaccagatctcgaactctttaccgctttaacataatgcatacgctttttcacagcaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3660093 |
catcatcatcaccttctggttttcttggtctctgaactttctgaccagatctcgaactctttaccgctttaacataatgcatacgctttttcgcagcaac |
3660192 |
T |
 |
| Q |
108 |
ctcttcaattgagtccaaaaactgaaccaaatctctactaatcgaccttttcccatccacaatcattgtatcacagtcctaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660193 |
ctcttcaattgagtccaaaaactgaaccaaatctctactaatcgaccttttcccatccacaatcattgtatcacagtcctaa |
3660274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University