View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17551_low_7 (Length: 250)
Name: NF17551_low_7
Description: NF17551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17551_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 6183545 - 6183782
Alignment:
| Q |
1 |
taactgttatatttgtaaaaagacgttaaatggtaaaaggtctcgtcacgtagttattccacgcttaaaaataaaatcaatgtgtcgcttttccattaga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||| |||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
6183545 |
taactgttatatttgtaaaatgacgttaaatggtaaaaagtctcgtcacgtggttatttcacgtttaaaaacaaaatcaatgtgtcgtttttccattaga |
6183644 |
T |
|
| Q |
101 |
tcgtggcaccgcaccgatacatttcaaaggaggtgtcttacggaagaaggaagtaattcaccttcatatgtgcaattagttgaagaagatattagtttag |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6183645 |
tcgtggcgccgcaccgatacatttcaaaggaggtgtcttacggaagaaggaagtaattcaccttcatatgtgcaatttgttgaagaagatattagtttag |
6183744 |
T |
|
| Q |
201 |
ccacatgggtaggcttatcattcttgacaattgctgtt |
238 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6183745 |
ccacatgggtagggttatcattcttgacaattgctgtt |
6183782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University