View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17552_low_11 (Length: 307)
Name: NF17552_low_11
Description: NF17552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17552_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 17 - 289
Target Start/End: Original strand, 3230258 - 3230530
Alignment:
| Q |
17 |
catatatcataagatttttaccttatgttggaggagtgggattctcacatcccaatattcacgatcggggtatttgcaaagcttcaaattgaaagtcaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3230258 |
catatatcataagatttttaccttatgttggaggagtgggattctcacgtcccaatgttcacgatcgtggtatttgcaaagcttcaaattgaaagtcaat |
3230357 |
T |
|
| Q |
117 |
aaatgtatgatgatgccatgcatacaaacacataatatatccacgaattcttttaagggttgctctcgtattcaaataatgttgcccattatagttataa |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3230358 |
aaatgtacgatgatgccatgcatacaaacacataatatatccacgaattcttttaagggttgctctcatattcaaataatgttgcccattatagttataa |
3230457 |
T |
|
| Q |
217 |
acattacgttaccctttatagtcactgaagttgtccttcttattgaatatctgaagaaagtaaggaagcaact |
289 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
3230458 |
acattacgttaccctttatagttactgaagttgtcctttttattgaatatctgaagaaagtaaggtagcaact |
3230530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University