View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17552_low_13 (Length: 280)
Name: NF17552_low_13
Description: NF17552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17552_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 51967883 - 51968130
Alignment:
| Q |
18 |
cacattctgctgtgtatattgccttaccctgccctgttttcacgctattcaaacagattccacagctactctgaatcaaacaataatatcaaaataaata |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51967883 |
cacattctgctgtgtatattgccttcccctgccccgttttcacgctattcaaacagattccacagctactctgaatcaaacaataatatcaaaataaata |
51967982 |
T |
 |
| Q |
118 |
aggcagatcagtatcattatttggatctcaataacataggaaaaaaggaattcataccctgaatttgaagctgtttttgaagagggacaacttcaaagga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51967983 |
aggcagatcagtatcattatttggatctcaataaaataggaaaaaaggaattcataccctgaatttgaagctgtttttgaagagggacaacttcaaagga |
51968082 |
T |
 |
| Q |
218 |
gagcgaggagaagtaggatttgatattgagttaactctaggggatttt |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968083 |
gagcgaggagaagtaggatttgatattgagttaactctaggggatttt |
51968130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University