View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17554_high_12 (Length: 328)
Name: NF17554_high_12
Description: NF17554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17554_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 13 - 313
Target Start/End: Original strand, 14564797 - 14565097
Alignment:
| Q |
13 |
ggagaggatagtcgtgttaacaacatagaggaggtgtgatctccattgttcttccaaggcagagatagcggcgatccagccaaagctgatggcagatcac |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14564797 |
ggagagggtagtcgtgttaacaacatagaggaggtgtgatctccgttgttcttccaaggcagagatagcggcgatccagccaaagctgatagcagatcac |
14564896 |
T |
 |
| Q |
113 |
catcaacgagacagccaaaaacaagagcgccaatgcaaagaacacaaattctacatgacgatggtggtgagccttggtaatatcatggtttctttctgcg |
212 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14564897 |
catcaacgagacagccgaaaacaagagagccaatgcgaagaacacaaattctacacgacgatggtggtgagccttggtaatatcatggtttctttctgcg |
14564996 |
T |
 |
| Q |
213 |
aagatcaggatcatgtttggtaaatgtgatcggactgagaagattgaggctgaaaatatcttgcaaaccaagaaacttcgaaagagaggagtgtgggttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14564997 |
aagatcaggatcatgtttggtaaatgtgatcggactgagaagattgaggctgaaaatatcttgcaaaccaagaaacttcgaaagagaggagtgtgggttt |
14565096 |
T |
 |
| Q |
313 |
t |
313 |
Q |
| |
|
| |
|
|
| T |
14565097 |
t |
14565097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University