View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17554_high_16 (Length: 238)
Name: NF17554_high_16
Description: NF17554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17554_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 22828999 - 22828777
Alignment:
| Q |
1 |
tctctatcgagtgcccaccttcctcccttctttgataatttgaagaattgataagcaagtaccattgcatgtttgataggagtgatgattaagggttaat |
100 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22828999 |
tctctgtcgagttcccaccttcctcccttctttgataatttgaagaattgaaaagcaactaccattgcatgtttgattagagtgatgattaagggttaat |
22828900 |
T |
 |
| Q |
101 |
gggtacttggaatc-agaagagggagattaagcaatgactaaaccatgggtattggatttgtgaatggtgaaagctgttacagccttggnnnnnnnatgg |
199 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
22828899 |
gggtacttgaaatcaagaagaggaagattaagcaatgactgaaccatgggtattggatttgtcaatggtgaaagctgttacagccttggttttttaatgg |
22828800 |
T |
 |
| Q |
200 |
agaattgaaaaaggagaggtttt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
22828799 |
agaattgaaaaaggagaggtttt |
22828777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University