View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17554_low_13 (Length: 346)
Name: NF17554_low_13
Description: NF17554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17554_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 31979961 - 31979672
Alignment:
| Q |
1 |
tcatatgtttctgaacaacatgaacaaggtggtttctttcatcatcatcaacatcattacccttattggcaacaaatggaacctatacagtttcaaacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979961 |
tcatatgtttctgaacaacatgaacaaggtggtttctttcatcat------------tacccttattggcaacaaatggaacctatacagtttcaaacac |
31979874 |
T |
 |
| Q |
101 |
cacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatcttcaactcctca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31979873 |
cacaacaacatcatgttgaagcagcaacaaacacttttcatcctatggttccttgcaatggttatgcttctggttttggtgcttcatcttccactcctca |
31979774 |
T |
 |
| Q |
201 |
ctatgtcttctccaacaatgctgcttcttcttctgcttctcctcagtttgttgatgcttctgaccatgtcaatcttgatctcactcttcacctttgaaaa |
300 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31979773 |
ctatgttttctccaacaatgctgcttctgcttctacttctcctcagtttgttgatgcttctgaccatgtcaatcttgatctcactcttcacctttgaaaa |
31979674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University