View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17555_high_5 (Length: 212)
Name: NF17555_high_5
Description: NF17555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17555_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 44611419 - 44611613
Alignment:
| Q |
9 |
cgaagaatatgtttgttgaatataaagataaaatgaatatttcttaggtttagtggattataggttcagtgatttgtttctgctgctgttggtttgtgct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44611419 |
cgaagaatatgtttgttgaatataaagataaaatgaatatttcttaggtttagtggattataggttcagtgatttgtttctgctgctgttggtttgtgct |
44611518 |
T |
|
| Q |
109 |
ctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggtttacagctttcgatggcttcattttcttgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44611519 |
ctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactgtttttcaggtttacagctttcgatggtttcattttcttgg |
44611613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 83 - 182
Target Start/End: Original strand, 13146114 - 13146213
Alignment:
| Q |
83 |
tgtttctgctgctgttggtttgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggtttacagctt |
182 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
13146114 |
tgtttatgctgctattggtttgtgctctgctgtctttttggtcttgagatcttcctagggttttggcttctgatgctattgtttttcaggtttacagctt |
13146213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 83 - 175
Target Start/End: Complemental strand, 26379661 - 26379569
Alignment:
| Q |
83 |
tgtttctgctgctgttggtttgtgctctgctgtctttttggtcttgagatcttcctaggattttggcttctgatgctactatttttcaggttt |
175 |
Q |
| |
|
||||||| ||| | ||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26379661 |
tgtttctactgttattggtttgtgctctgctgtttttttggtcttgagatctttctagggttttggcttctgatgctactatttttcaggttt |
26379569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 178
Target Start/End: Original strand, 22247022 - 22247058
Alignment:
| Q |
142 |
attttggcttctgatgctactatttttcaggtttaca |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22247022 |
attttggcttttgatgctactatttttcaggtttaca |
22247058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University