View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17556_high_11 (Length: 393)
Name: NF17556_high_11
Description: NF17556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17556_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 16 - 379
Target Start/End: Original strand, 4830876 - 4831239
Alignment:
| Q |
16 |
taaacaacaccaagaacaagaagatgaagattcatgggaggtaagggcttttgctgaagacacaaggaatattatgaacacaacatggccaccaaggtcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4830876 |
taaacaacaccaagaacaagaagatgaagattcatgggaggtaagggcttttgctgaagacacaaggaatattatgaacacaacatggccaccaaggtcc |
4830975 |
T |
|
| Q |
116 |
tacacctgcaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttcaccgccgcgaccgtgctcgtctccatcaaaccc |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4830976 |
tacacctgtaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttcaccgccgcgaccgtgctcgtctccatcaaaccc |
4831075 |
T |
|
| Q |
216 |
aaccaccgttaaattcatctcatccttcatcaccattcataaatattcctccacaagaccttgttgctaatgctggattgtgccttctttaccatttacc |
315 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831076 |
aaccaccgttaaattcttctcatccttcatcaccattcataaatattcctccacaagaccttgttgctaatgctggattgtgccttctttaccatttacc |
4831175 |
T |
|
| Q |
316 |
aaaccctaataataatgcttttgcttccttcaatagttctagtcctaatggagaatctccttct |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4831176 |
aaaccctaataataatgcttttgcttccttcaatagttctagtcctaatggagaatctccttct |
4831239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 183
Target Start/End: Original strand, 34522611 - 34522667
Alignment:
| Q |
127 |
cttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttca |
183 |
Q |
| |
|
|||||| | ||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
34522611 |
cttttgtaaaagagagtttaggtctgctcaagctcttggtggtcacatgaatattca |
34522667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 99 - 183
Target Start/End: Complemental strand, 31844623 - 31844539
Alignment:
| Q |
99 |
catggccaccaaggtcctacacctgcaccttttgcagaagagagttccggtcagctcaagctcttggtggtcacatgaatgttca |
183 |
Q |
| |
|
||||||||||||| || ||||| || | |||||| |||| |||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31844623 |
catggccaccaagatcatacacatgtagcttttgtagaaaagagtttaaatcagctcaagcacttggaggtcacatgaatgttca |
31844539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University