View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17556_high_14 (Length: 356)
Name: NF17556_high_14
Description: NF17556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17556_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 144 - 340
Target Start/End: Original strand, 40429369 - 40429576
Alignment:
| Q |
144 |
atataaaattgttttggggtttgtccaaaattgtctagttcacttgcccttgcatggacccgaaacaaggctcgccaattccccatcccataaacgacaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40429369 |
atataaaattgttttggggtttgtccaaaattgtctagttcacttgcccttgcatggacccgaaacaaggcacgccaattccccatcccataaacgacaa |
40429468 |
T |
 |
| Q |
244 |
tccagtactgtaacacctttgtcacgtccttcgtgtcattacgttagaa-----------gtctggattcaccttgatcacgatagagtcataaactatt |
332 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| || ||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40429469 |
tccagtactgtaacaccattgtcacgtccttcgtgtcactatgttagaacttagaagtctggctggattcaccttgatcacgatagagtcataaactatt |
40429568 |
T |
 |
| Q |
333 |
ggaatatg |
340 |
Q |
| |
|
|||||||| |
|
|
| T |
40429569 |
ggaatatg |
40429576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 40429246 - 40429291
Alignment:
| Q |
18 |
attctgcttgacccaacttccattgatagtacatgataatatttgg |
63 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40429246 |
attctccttgacccaacttccattgatagtacatgataatatttgg |
40429291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University