View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17556_low_34 (Length: 234)
Name: NF17556_low_34
Description: NF17556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17556_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 28 - 219
Target Start/End: Complemental strand, 38929775 - 38929574
Alignment:
| Q |
28 |
gccttgaattatcagtctccccaacactccagcaccttt----------attagtttcctaaaaaggtccacaactttaatcgcaagcatttttaagtca |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929775 |
gccttgaattattagtctccccaacactccagcaccttttgagtactttattagtctcctaaaaaggtccacaactttaatcgcaagcatttttaagtca |
38929676 |
T |
 |
| Q |
118 |
aatttatggtttagtaaattatccgttcacccccacaacttgtaagagtcgagcattcacacctctaaaatttgcgaatatgcaaaattgatcctctaac |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929675 |
aatttatggtttagtaaattatccattcatccccacaacttgtaagagtcgagcattcacacctctaaaatttgcgaatatgcaaaattgatcctctaac |
38929576 |
T |
 |
| Q |
218 |
at |
219 |
Q |
| |
|
|| |
|
|
| T |
38929575 |
at |
38929574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University