View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17557_low_4 (Length: 358)
Name: NF17557_low_4
Description: NF17557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17557_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 13 - 165
Target Start/End: Original strand, 9861126 - 9861278
Alignment:
| Q |
13 |
aatattgataaagcttgattgtgaacgagttgttcacaatgcagctagcttttcctttgcacacaatagtgaatatgtatcatggnnnnnnnttaatcac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9861126 |
aatattgataaagcttgattgtgaacgagttgttcacaatgccgctagcttttcctttgcacacaatagtgaatatgtatcatggaaaaaaattaatcac |
9861225 |
T |
 |
| Q |
113 |
cagcaagtttacaaattgaattgcctattacaaataatgaatgaacaatgaat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9861226 |
cagcaagtttacaaattgaattgcctattacaaataatgaatgaacaatgaat |
9861278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University