View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17557_low_9 (Length: 215)
Name: NF17557_low_9
Description: NF17557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17557_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 91 - 197
Target Start/End: Complemental strand, 7506422 - 7506316
Alignment:
| Q |
91 |
gattgtttaaagatcaagcaagacatacattacaatggagccttttgagcataagggaaataaccaaagcaatataatcataatctcctctattttaccg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7506422 |
gattgtttaaagatcaagcaagacatacattacaatggagccttttgagcataagggaaataaccaaaacaatataatcataatctcctctattttacca |
7506323 |
T |
 |
| Q |
191 |
gtcctct |
197 |
Q |
| |
|
||||||| |
|
|
| T |
7506322 |
gtcctct |
7506316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 94
Target Start/End: Complemental strand, 7506557 - 7506476
Alignment:
| Q |
13 |
gattattctaaagtatgtacttgtccaaaccaatgtatttcgcccatccaagtgcctctaaaatagtttacatttgaagatt |
94 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7506557 |
gattcttctaaagtatgtatttgtccaaaccaatgtatttcgcccatccaagtgcctctaaaatagtttacatttgaagatt |
7506476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University